Target Regulator(s) Information (MicroRNA)

Content Navigation (  All   None )                                      
Target General Information
The microRNAs (miRNAs) Regulating This Target
References
Target General Information  Top
Target ID T49755 Target Info
Target Name LDL receptor related protein-6 (LRP-6)
Synonyms Low-density lipoprotein receptor-related protein 6
Target Type Clinical trial Target
Gene Name LRP6
Biochemical Class Low density lipoprotein receptor
UniProt ID
O75581
The microRNAs (miRNAs) Regulating This Target  Top
miRNA Mature ID hsa-miR-126-3p miRNA Info
miRNA Mature AC
MIMAT0000445
Sequence ucguaccgugaguaauaaugcg
miRNA Species Homo sapiens
Regulation Mechanism TPC-1 cells transfected with miR-126 mimic repressed wild-type LRP6-3'UTR reporter activity, while miR-126 mimic had no inhibition effect on the mutant LRP6-3'UTR reporter activity. [2]
Evidence Score (E-score) 2 +
1 Luciferase Reporter Assay; qRT-PCR; Western Blot [1]
2 Luciferase Reporter Assay; Western Blot [2]
Representative Target(s) Regulated by This miRNA Adrenomedullin (ADM) Target Info
ADML_HUMAN
Angiopoietin 1 receptor (TEK) Target Info
TIE2_HUMAN
miRNA Mature ID hsa-miR-202-3p miRNA Info
miRNA Mature AC
MIMAT0002811
Sequence agagguauagggcaugggaa
miRNA Species Homo sapiens
Regulation Mechanism Ectopic expression of miR-202 decreased the luciferase activity of the pGL3-LRP6-3'UTR-luciferase reporter, and suppression of miR- 202 increased luciferase production. [4]
Evidence Score (E-score) 2 +
1 Dual Luciferase Reporter Assay [3]
2 Luciferase Reporter Assay; Western Blot [4]
Representative Target(s) Regulated by This miRNA B-cell-activating factor (TNFSF13B) Target Info
TN13B_HUMAN
LDL receptor related protein-6 (LRP-6) Target Info
LRP6_HUMAN
miRNA Mature ID hsa-miR-183-5p miRNA Info
miRNA Mature AC
MIMAT0000261
Sequence uauggcacugguagaauucacu
miRNA Species Homo sapiens
Regulation Mechanism miR-183 represses the expression of LRP6 and directly targets its mRNA through the first putative binding site in RB cells. [5]
Evidence Score (E-score) 1 +
1 Luciferase Reporter Assay; Western Blot [5]
Representative Target(s) Regulated by This miRNA Dickkopf-related protein 3 (DKK3) Target Info
DKK3_HUMAN
Early growth response protein 1 (EGR-1) Target Info
EGR1_HUMAN
miRNA Mature ID hsa-miR-21-5p miRNA Info
miRNA Mature AC
MIMAT0000076
Sequence uagcuuaucagacugauguuga
miRNA Species Homo sapiens
Regulation Mechanism miR-21 specifically inhibits LRP6 expression. [6]
Evidence Score (E-score) 1 +
1 Luciferase Reporter Assay; Western Blot [6]
Representative Target(s) Regulated by This miRNA Apoptosis antigen ligand (CD178) Target Info
TNFL6_HUMAN
Apoptosis regulator Bcl-2 (BCL-2) Target Info
BCL2_HUMAN
miRNA Mature ID hsa-miR-29c-3p miRNA Info
miRNA Mature AC
MIMAT0000681
Sequence uagcaccauuugaaaucgguua
miRNA Species Homo sapiens
Regulation Mechanism miR-29c binds directly with the 3'UTR of LRP6. [7]
Evidence Score (E-score) 1 +
1 Immunoprecipitation; Luciferase Reporter Assay [7]
Representative Target(s) Regulated by This miRNA Apoptosis regulator Bcl-2 (BCL-2) Target Info
BCL2_HUMAN
B7 homolog 3 (CD276) Target Info
CD276_HUMAN
References  Top
REF 1 miR-126 inhibits papillary thyroid carcinoma growth by targeting LRP6. Oncol Rep. 2015 Oct;34(4):2202-10.
REF 2 MiR-126 promotes coxsackievirus replication by mediating cross-talk of ERK1/2 and Wnt/-catenin signal pathways. Cell Mol Life Sci. 2013 Dec;70(23):4631-44.
REF 3 miR-202-3p Regulates Sertoli Cell Proliferation, Synthesis Function, and Apoptosis by Targeting LRP6 and Cyclin D1 of Wnt/beta-Catenin Signaling. Mol Ther Nucleic Acids. 2019 Mar 1;14:1-19.
REF 4 miR-202 suppresses cell proliferation in human hepatocellular carcinoma by downregulating LRP6 post-transcriptionally. FEBS Lett. 2014 May 21;588(10):1913-20.
REF 5 MicroRNA-183 suppresses retinoblastoma cell growth, invasion and migration by targeting LRP6. FEBS J. 2014 Mar;281(5):1355-65.
REF 6 Mutation of miR-21 targets endogenous lipoprotein receptor-related protein 6 and nonalcoholic fatty liver disease. Am J Transl Res. 2017 Feb 15;9(2):715-721.
REF 7 Reduction of miR-29c enhances pancreatic cancer cell migration and stem cell-like phenotype. Oncotarget. 2015 Feb 20;6(5):2767-78.

If You Find Any Error in Data or Bug in Web Service, Please Kindly Report It to Dr. Zhou and Dr. Zhang.