Target Regulator(s) Information (MicroRNA)

Content Navigation (  All   None )                                      
Target General Information
The microRNAs (miRNAs) Regulating This Target
References
Target General Information  Top
Target ID T52297 Target Info
Target Name Oxysterols receptor LXR-alpha (NR1H3)
Synonyms Nuclear receptor subfamily 1 group H member 3; Nuclear receptor LXRalpha; Nuclear orphan receptor LXR-alpha; Liver X receptor alpha; LXRalpha; LXRA
Target Type Patented-recorded Target
Gene Name NR1H3
Biochemical Class Nuclear hormone receptor
UniProt ID
Q13133
The microRNAs (miRNAs) Regulating This Target  Top
miRNA Mature ID hsa-miR-613 miRNA Info
miRNA Mature AC
MIMAT0003281
Sequence aggaauguuccuucuuugcc
miRNA Species Homo sapiens
Evidence Score (E-score) 3 +
1 Luciferase Reporter Assay [1]
2 Luciferase Reporter Assay; Western Blot [2]
3 qRT-PCR; Luciferase Reporter Assay; Western Blot [3]
Representative Target(s) Regulated by This miRNA ATP-binding cassette transporter A1 (ABCA1) Target Info
ABCA1_HUMAN
Brain-derived neurotrophic factor (BDNF) Target Info
BDNF_HUMAN
miRNA Mature ID hsa-miR-155-5p miRNA Info
miRNA Mature AC
MIMAT0000646
Sequence uuaaugcuaaucgugauagggguu
miRNA Species Homo sapiens
Evidence Score (E-score) 1 +
1 Luciferase Reporter Assay; Western Blot [4]
Representative Target(s) Regulated by This miRNA Acetyl-CoA transporter (SLC33A1) Target Info
ACATN_HUMAN
Angiotensin II receptor type-1 (AGTR1) Target Info
AGTR1_HUMAN
miRNA Mature ID hsa-miR-206 miRNA Info
miRNA Mature AC
MIMAT0000462
Sequence uggaauguaaggaagugugugg
miRNA Species Homo sapiens
Regulation Mechanism Stably overexpressing miR-206 in THP-1 human macrophages revealed an up-regulation and miR-206 knockdown led to a down-regulation of LXRalpha and its target genes. [5]
Evidence Score (E-score) 1 +
1 Luciferase Reporter Assay; Western Blot [5]
Representative Target(s) Regulated by This miRNA Annexin A2 (ANXA2) Target Info
ANXA2_HUMAN
Apoptosis regulator Bcl-2 (BCL-2) Target Info
BCL2_HUMAN
References  Top
REF 1 MicroRNA-613 represses lipogenesis in HepG2 cells by downregulating LXR. Lipids Health Dis. 2013 Mar 8;12:32.
REF 2 MicroRNA hsa-miR-613 targets the human LXR gene and mediates a feedback loop of LXR autoregulation. Mol Endocrinol. 2011 Apr;25(4):584-96.
REF 3 miR-613 regulates cholesterol efflux by targeting LXR and ABCA1 in PPAR activated THP-1 macrophages. Biochem Biophys Res Commun. 2014 Jun 6;448(3):329-34.
REF 4 The role of microRNA-155/liver X receptor pathway in experimental and idiopathic pulmonary fibrosis. J Allergy Clin Immunol. 2017 Jun;139(6):1946-1956.
REF 5 miR-206 controls LXR expression and promotes LXR-mediated cholesterol efflux in macrophages. Biochim Biophys Acta. 2014 Jun;1841(6):827-35.

If You Find Any Error in Data or Bug in Web Service, Please Kindly Report It to Dr. Zhou and Dr. Zhang.