The microRNAs (miRNAs) Regulating This Target |
Top |
miRNA Mature ID |
hsa-miR-125a-5p |
miRNA Info
|
miRNA Mature AC |
|
Sequence |
ucccugagacccuuuaaccuguga
|
miRNA Species |
Homo sapiens |
Evidence Score (E-score) |
1 |
+ |
1 |
Luciferase Reporter Assay; Western Blot |
[1] |
Representative Target(s) Regulated by This miRNA |
Apoptosis regulator BAK (BAK)
|
Target Info
|
|
Apoptosis regulator Bcl-2 (BCL-2)
|
Target Info
|
|
miRNA Mature ID |
hsa-miR-130a-3p |
miRNA Info
|
miRNA Mature AC |
|
Sequence |
cagugcaauguuaaaagggcau
|
miRNA Species |
Homo sapiens |
Regulation Mechanism |
miR-30a directly targets the 3'UTR of DLL4 Mrna. |
[2] |
Evidence Score (E-score) |
1 |
+ |
1 |
Luciferase Reporter Assay |
[2] |
Representative Target(s) Regulated by This miRNA |
Activin receptor-like kinase 2 (ALK-2)
|
Target Info
|
|
Amyloid beta A4 protein (APP)
|
Target Info
|
|
miRNA Mature ID |
hsa-miR-296-5p |
miRNA Info
|
miRNA Mature AC |
|
Sequence |
agggcccccccucaauccugu
|
miRNA Species |
Homo sapiens |
Regulation Mechanism |
mRNA and protein levels of DLL4 was significantly reduced in the HUEVCs stably overexpressing miR-296. |
[3] |
Evidence Score (E-score) |
1 |
+ |
1 |
qRT-PCR; Western Blot |
[3] |
Representative Target(s) Regulated by This miRNA |
Apoptosis regulator Bcl-2 (BCL-2)
|
Target Info
|
|
Bcl-2-binding component 3 (BBC3)
|
Target Info
|
|
miRNA Mature ID |
hsa-miR-30b-5p |
miRNA Info
|
miRNA Mature AC |
|
Sequence |
uguaaacauccuacacucagcu
|
miRNA Species |
Homo sapiens |
Regulation Mechanism |
miR-30 influences the expression of DLL4 in endothelial cells by targeting a site within its 3'UTR. |
[4] |
Evidence Score (E-score) |
1 |
+ |
1 |
In Situ Hybridization; Luciferase Reporter Assay; Western Blot |
[4] |
Representative Target(s) Regulated by This miRNA |
Apoptosis regulator Bcl-2 (BCL-2)
|
Target Info
|
|
Beclin-1 (BECN1)
|
Target Info
|
|