Content Navigation
( All
None )
| Target General Information |
Top |
| Target ID |
T56923 |
Target Info
|
| Target Name |
C-X-C chemokine receptor type 2 (CXCR2) |
| Synonyms |
Interleukin-8 receptor B; IL8RB; IL-8R B; IL-8 receptor type 2; High affinity interleukin-8 receptor B; GRO/MGSA receptor; CXCR-2; CXC-R2; CDw128b; CD182 |
| Target Type |
Successful Target |
| Gene Name |
CXCR2 |
| Biochemical Class |
GPCR rhodopsin |
| UniProt ID |
|
| The microRNAs (miRNAs) Regulating This Target |
Top |
| miRNA Mature ID |
hsa-miR-22-3p |
miRNA Info
|
| miRNA Mature AC |
|
| Sequence |
aagcugccaguugaagaacugu
|
| miRNA Species |
Homo sapiens |
| Regulation Mechanism |
Wild type of CXCR2 significantly reduced expression in the presence of miR- 22-3p, whereas no suppression of activity was observed for the mutant. |
[1] |
| Evidence Score (E-score) |
1 |
+ |
| 1 |
Luciferase Reporter Assay; Western Blot |
[1] |
| Representative Target(s) Regulated by This miRNA |
5-HT 2C receptor (HTR2C)
|
Target Info
|
|
|
ATP-citrate synthase (ACLY)
|
Target Info
|
|
| References |
Top |
| REF 1 |
The lncRNA MALAT1 protects the endothelium against ox-LDL-induced dysfunction via upregulating the expression of the miR-22-3p target genes CXCR2 and AKT. FEBS Lett. 2015 Oct 7;589(20 Pt B):3189-96.
|
If You Find Any Error in Data or Bug in Web Service, Please Kindly Report It to Dr. Zhou and Dr. Zhang.
