Content Navigation
( All
None )
| Target General Information |
Top |
| Target ID |
T62431 |
Target Info
|
| Target Name |
Tyrosine-protein kinase SYK (SYK) |
| Synonyms |
p72-Syk; Spleen tyrosine kinase |
| Target Type |
Successful Target |
| Gene Name |
SYK |
| Biochemical Class |
Kinase |
| UniProt ID |
|
| The microRNAs (miRNAs) Regulating This Target |
Top |
| miRNA Mature ID |
hsa-miR-532-5p |
miRNA Info
|
| miRNA Mature AC |
|
| Sequence |
caugccuugaguguaggaccgu
|
| miRNA Species |
Homo sapiens |
| Evidence Score (E-score) |
1 |
+ |
| 1 |
qRT-PCR; Western Blot |
[1] |
| Representative Target(s) Regulated by This miRNA |
C-X-C motif chemokine 2 (CXCL2)
|
Target Info
|
|
|
Fatty acid synthase (FASN)
|
Target Info
|
|
| References |
Top |
| REF 1 |
Computational and in vitro Investigation of miRNA-Gene Regulations in Retinoblastoma Pathogenesis: miRNA Mimics Strategy. Bioinform Biol Insights. 2015 May 12;9:89-101.
|
If You Find Any Error in Data or Bug in Web Service, Please Kindly Report It to Dr. Zhou and Dr. Zhang.
