Target Regulator(s) Information (MicroRNA)

Content Navigation (  All   None )                                      
Target General Information
The microRNAs (miRNAs) Regulating This Target
References
Target General Information  Top
Target ID T62460 Target Info
Target Name Janus kinase 1 (JAK-1)
Synonyms Tyrosine-protein kinase JAK1; JAK1B; JAK1A
Target Type Successful Target
Gene Name JAK1
Biochemical Class Kinase
UniProt ID
P23458
The microRNAs (miRNAs) Regulating This Target  Top
miRNA Mature ID hsa-miR-106b-5p miRNA Info
miRNA Mature AC
MIMAT0000680
Sequence uaaagugcugacagugcagau
miRNA Species Homo sapiens
Evidence Score (E-score) 2 +
1 Luciferase Reporter Assay; qRT-PCR; Western Blot [1]
2 Microarray [2]
Representative Target(s) Regulated by This miRNA Amyloid beta A4 protein (APP) Target Info
A4_HUMAN
Apoptosis mediating surface antigen FAS (FAS) Target Info
TNR6_HUMAN
miRNA Mature ID hsa-miR-17-5p miRNA Info
miRNA Mature AC
MIMAT0000070
Sequence caaagugcuuacagugcagguag
miRNA Species Homo sapiens
Regulation Mechanism The overexpression of miR-17-5p by mature miRNA precursor transfection resulted in the decreased protein level of target JAK1. [3]
Evidence Score (E-score) 2 +
1 Luciferase Reporter Assay; Western Blot; qRT-PCR [3]
2 Western Blot [4]
Representative Target(s) Regulated by This miRNA Amyloid beta A4 protein (APP) Target Info
A4_HUMAN
Apoptosis mediating surface antigen FAS (FAS) Target Info
TNR6_HUMAN
miRNA Mature ID hsa-miR-107 miRNA Info
miRNA Mature AC
MIMAT0000104
Sequence agcagcauuguacagggcuauca
miRNA Species Homo sapiens
Regulation Mechanism miR-107 targets expression of JAK1 and inhibits IL-6 signaling and impairs STAT3 activation in human hepatocytes. [5]
Evidence Score (E-score) 1 +
1 Luciferase Reporter Assay; Western Blot; Co-Immunoprecipitation [5]
Representative Target(s) Regulated by This miRNA Beta-secretase 1 (BACE1) Target Info
BACE1_HUMAN
Caveolin 1 (CAV1) Target Info
CAV1_HUMAN
miRNA Mature ID hsa-miR-20a-5p miRNA Info
miRNA Mature AC
MIMAT0000075
Sequence uaaagugcuuauagugcagguag
miRNA Species Homo sapiens
Regulation Mechanism The overexpression of miR-20a-5p by mature miRNA precursor transfection resulted in the decreased protein level of target JAK1. [3]
Evidence Score (E-score) 1 +
1 Western Blot; qRT-PCR [3]
Representative Target(s) Regulated by This miRNA Amyloid beta A4 protein (APP) Target Info
A4_HUMAN
Apoptosis regulator Bcl-2 (BCL-2) Target Info
BCL2_HUMAN
miRNA Mature ID hsa-miR-373-3p miRNA Info
miRNA Mature AC
MIMAT0000726
Sequence gaagugcuucgauuuuggggugu
miRNA Species Homo sapiens
Evidence Score (E-score) 1 +
1 Immunoprecipitation; Luciferase Reporter Assay; Western Blot [6]
Representative Target(s) Regulated by This miRNA B-cell translocation gene 1 protein (BTG1) Target Info
BTG1_HUMAN
Cell surface protein HB15 (CD83) Target Info
CD83_HUMAN
References  Top
REF 1 A MDM2-dependent positive-feedback loop is involved in inhibition of miR-375 and miR-106b induced by Helicobacter pylori lipopolysaccharide. Int J Cancer. 2015 May 1;136(9):2120-31.
REF 2 Transcripts targeted by the microRNA-16 family cooperatively regulate cell cycle progression. Mol Cell Biol. 2007 Mar;27(6):2240-52.
REF 3 Members of the microRNA-17-92 cluster exhibit a cell-intrinsic antiangiogenic function in endothelial cells. Blood. 2010 Jun 10;115(23):4944-50.
REF 4 Expression, regulation and mechanism of action of the miR-17-92 cluster in tumor cells (Review). Int J Mol Med. 2017 Dec;40(6):1624-1630.
REF 5 Hepatitis C virus-induced changes in microRNA 107 (miRNA-107) and miRNA-449a modulate CCL2 by targeting the interleukin-6 receptor complex in hepatitis. J Virol. 2014 Apr;88(7):3733-43.
REF 6 Hepatitis C virus-mediated enhancement of microRNA miR-373 impairs the JAK/STAT signaling pathway. J Virol. 2015 Mar;89(6):3356-65.

If You Find Any Error in Data or Bug in Web Service, Please Kindly Report It to Dr. Zhou and Dr. Zhang.