Target Regulator(s) Information (MicroRNA)

Content Navigation (  All   None )                                      
Target General Information
The microRNAs (miRNAs) Regulating This Target
References
Target General Information  Top
Target ID T66903 Target Info
Target Name Fascin (FSCN1)
Synonyms Singed-like protein; SNL; HSN; FAN1; 55 kDa actin-bundling protein; 55 kDa actin bundling protein
Target Type Clinical trial Target
Gene Name FSCN1
UniProt ID
Q16658
The microRNAs (miRNAs) Regulating This Target  Top
miRNA Mature ID hsa-miR-145-5p miRNA Info
miRNA Mature AC
MIMAT0000437
Sequence guccaguuuucccaggaaucccu
miRNA Species Homo sapiens
Regulation Mechanism The overexpression of miR-145-5p by mature miRNA precursor transfection resulted in the decreased protein level of target FSCN1. [9]
Evidence Score (E-score) 11 +
1 Immunoblot; Immunohistochemistry; Luciferase Reporter Assay [1]
2 Immunofluorescence; qRT-PCR; Western Blot [2]
3 Luciferase Reporter Assay [3]
4 Luciferase Reporter Assay; Microarray; qRT-PCR; Western Blot [4]
5 Luciferase Reporter Assay; qRT-PCR; Western Blot [5]
6 Luciferase Reporter Assay; qRT-PCR; Western Blot [6]
7 Luciferase Reporter Assay; qRT-PCR; Western Blot [7]
8 Luciferase Reporter Assay; qRT-PCR; Western Blot [8]
9 Luciferase Reporter Assay; qRT-PCR; Western Blot [9]
10 Luciferase Reporter Assay; Western Blot [10]
11 Western Blot [11]
Representative Target(s) Regulated by This miRNA A proliferation-inducing ligand (APRIL) Target Info
TNF13_HUMAN
Alkaline phosphatase (ALPPL2) Target Info
PPBN_HUMAN
miRNA Mature ID hsa-miR-133b miRNA Info
miRNA Mature AC
MIMAT0000770
Sequence uuugguccccuucaaccagcua
miRNA Species Homo sapiens
Regulation Mechanism FSCN1 as a target of miR-133b. [4]
Evidence Score (E-score) 4 +
1 Immunohistochemistry; qRT-PCR [12]
2 Luciferase Reporter Assay; qRT-PCR; Western Blot [13]
3 Luciferase Reporter Assay; Western Blot [14]
4 Luciferase Reporter Assay; Western Blot [4]
Representative Target(s) Regulated by This miRNA Apoptosis mediating surface antigen FAS (FAS) Target Info
TNR6_HUMAN
Apoptosis regulator Bcl-W (BCL-W) Target Info
B2CL2_HUMAN
miRNA Mature ID hsa-miR-143-3p miRNA Info
miRNA Mature AC
MIMAT0000435
Sequence ugagaugaagcacuguagcuc
miRNA Species Homo sapiens
Evidence Score (E-score) 2 +
1 Luciferase Reporter Assay; qRT-PCR; Western Blot [15]
2 Western Blot [11]
Representative Target(s) Regulated by This miRNA Apoptosis regulator Bcl-2 (BCL-2) Target Info
BCL2_HUMAN
Connective tissue growth factor (CTGF) Target Info
CTGF_HUMAN
miRNA Mature ID hsa-miR-133a-3p miRNA Info
miRNA Mature AC
MIMAT0000427
Sequence uuugguccccuucaaccagcug
miRNA Species Homo sapiens
Regulation Mechanism The overexpression of miR-133a-3p by mature miRNA precursor transfection resulted in the decreased protein level of target FSCN1. [9]
Evidence Score (E-score) 1 +
1 Luciferase Reporter Assay [9]
Representative Target(s) Regulated by This miRNA Caspase-9 (CASP9) Target Info
CASP9_HUMAN
Fascin (FSCN1) Target Info
FSCN1_HUMAN
miRNA Mature ID hsa-miR-200b-3p miRNA Info
miRNA Mature AC
MIMAT0000318
Sequence uaauacugccugguaaugauga
miRNA Species Homo sapiens
Regulation Mechanism FSCN1 is a novel target of miR-200b and miR-200b directly binds to the 3'UTR of FSCN1. [16]
Evidence Score (E-score) 1 +
1 Luciferase Reporter Assay; Western Blot [16]
Representative Target(s) Regulated by This miRNA Apoptosis regulator Bcl-2 (BCL-2) Target Info
BCL2_HUMAN
CDK inhibitor 1B p27Kip1 (CDKN1B) Target Info
CDN1B_HUMAN
miRNA Mature ID hsa-miR-326 miRNA Info
miRNA Mature AC
MIMAT0000756
Sequence ccucugggcccuuccuccag
miRNA Species Homo sapiens
Regulation Mechanism miR-326 served as a tumor suppressor in gastric cancer via directly regulating FSCN1. [17]
Evidence Score (E-score) 1 +
1 Luciferase Reporter Assay; Western Blot [17]
Representative Target(s) Regulated by This miRNA Apoptosis regulator Bcl-xL (BCL-xL) Target Info
B2CL1_HUMAN
Fascin (FSCN1) Target Info
FSCN1_HUMAN
miRNA Mature ID hsa-miR-429 miRNA Info
miRNA Mature AC
MIMAT0001536
Sequence uaauacugucugguaaaaccgu
miRNA Species Homo sapiens
Regulation Mechanism miR-429 acts as a tumor suppressor by targeting FSCN1, suggesting that miR-429 and FSCN1 can both be potential therapeutic targets of GC. [18]
Evidence Score (E-score) 1 +
1 Immunohistochemistry; Luciferase Reporter Assay; Western Blot [18]
Representative Target(s) Regulated by This miRNA Apoptosis regulator Bcl-2 (BCL-2) Target Info
BCL2_HUMAN
DNA [cytosine-5]-methyltransferase 1 (DNMT1) Target Info
DNMT1_HUMAN
References  Top
REF 1 MicroRNA-145 inhibits tumour growth and metastasis in colorectal cancer by targeting fascin-1. Br J Cancer. 2014 Apr 29;110(9):2300-9.
REF 2 miR-145 suppresses breast cancer cell migration by targeting FSCN-1 and inhibiting epithelial-mesenchymal transition. Am J Transl Res. 2016 Jul 15;8(7):3106-14.
REF 3 Restoration of miR-145 expression suppresses cell proliferation, migration and invasion in prostate cancer by targeting FSCN1. Int J Oncol. 2011 Apr;38(4):1093-101.
REF 4 miR-145, miR-133a and miR-133b: Tumor-suppressive miRNAs target FSCN1 in esophageal squamous cell carcinoma. Int J Cancer. 2010 Dec 15;127(12):2804-14.
REF 5 MicroRNA 45 inhibits the malignant phenotypes of gastric carcinoma cells via downregulation of fascin 1 expression. Mol Med Rep. 2016 Jan;13(1):1033-9.
REF 6 MicroRNA-145 and MicroRNA-133a Inhibited Proliferation, Migration, and Invasion, While Promoted Apoptosis in Hepatocellular Carcinoma Cells Via Targeting FSCN1. Dig Dis Sci. 2015 Oct;60(10):3044-52.
REF 7 Reverse Correlation between MicroRNA-145 and FSCN1 Affecting Gastric Cancer Migration and Invasion. PLoS One. 2015 May 26;10(5):e0126890.
REF 8 MiR-145 inhibits metastasis by targeting fascin actin-bundling protein 1 in nasopharyngeal carcinoma. PLoS One. 2015 Mar 27;10(3):e0122228.
REF 9 miR-145 and miR-133a function as tumour suppressors and directly regulate FSCN1 expression in bladder cancer. Br J Cancer. 2010 Mar 2;102(5):883-91.
REF 10 MicroRNA-145 inhibits migration and invasion by down-regulating FSCN1 in lung cancer. Int J Clin Exp Med. 2015 Jun 15;8(6):8794-802.
REF 11 MiRNA profile in esophageal squamous cell carcinoma: downregulation of miR-143 and miR-145. World J Gastroenterol. 2011 Jan 7;17(1):79-88.
REF 12 Fascin-1 overexpression and miR-133b downregulation in the progression of gastrointestinal stromal tumor. Mod Pathol. 2013 Apr;26(4):563-71.
REF 13 The role of microRNA-133b and its target gene FSCN1 in gastric cancer. J Exp Clin Cancer Res. 2014 Nov 30;33:99.
REF 14 MicroRNA-133b inhibits the migration and invasion of non small cell lung cancer cells via targeting FSCN1. Oncol Lett. 2016 Nov;12(5):3619-3625.
REF 15 The cluster of miR-143 and miR-145 affects the risk for esophageal squamous cell carcinoma through co-regulating fascin homolog 1. PLoS One. 2012;7(3):e33987.
REF 16 miR-200b inhibits migration and invasion in non-small cell lung cancer cells via targeting FSCN1. Mol Med Rep. 2016 Aug;14(2):1835-40.
REF 17 Down-regulation of miR-326 is associated with poor prognosis and promotes growth and metastasis by targeting FSCN1 in gastric cancer. Growth Factors. 2015;33(4):267-74.
REF 18 miR-429 functions as a tumor suppressor by targeting FSCN1 in gastric cancer cells. Onco Targets Ther. 2016 Mar 3;9:1123-33.

If You Find Any Error in Data or Bug in Web Service, Please Kindly Report It to Dr. Zhou and Dr. Zhang.