Target Regulator(s) Information (MicroRNA)

Content Navigation (  All   None )                                      
Target General Information
The microRNAs (miRNAs) Regulating This Target
References
Target General Information  Top
Target ID T73404 Target Info
Target Name Activated leukocyte cell adhesionmolecule (ALCAM)
Synonyms MEMD; CD166 antigen; CD166; Activated leukocyte cell adhesion molecule
Target Type Clinical trial Target
Gene Name ALCAM
Biochemical Class Basigin protein
UniProt ID
Q13740
The microRNAs (miRNAs) Regulating This Target  Top
miRNA Mature ID hsa-miR-192-5p miRNA Info
miRNA Mature AC
MIMAT0000222
Sequence cugaccuaugaauugacagcc
miRNA Species Homo sapiens
Evidence Score (E-score) 2 +
1 Immunohistochemistry; Luciferase Reporter Assay; Microarray; qRT-PCR; Western Blot [1]
2 Microarray [2]
Representative Target(s) Regulated by This miRNA Activated leukocyte cell adhesionmolecule (ALCAM) Target Info
CD166_HUMAN
Activin receptor type IIB (ACVR2B) Target Info
AVR2B_HUMAN
miRNA Mature ID hsa-miR-215-5p miRNA Info
miRNA Mature AC
MIMAT0000272
Sequence augaccuaugaauugacagac
miRNA Species Homo sapiens
Evidence Score (E-score) 2 +
1 Immunohistochemistry; Luciferase Reporter Assay; Microarray; qRT-PCR; Western Blot [1]
2 Microarray [3]
Representative Target(s) Regulated by This miRNA Activated leukocyte cell adhesionmolecule (ALCAM) Target Info
CD166_HUMAN
Activin receptor type IIB (ACVR2B) Target Info
AVR2B_HUMAN
miRNA Mature ID hsa-miR-148a-3p miRNA Info
miRNA Mature AC
MIMAT0000243
Sequence ucagugcacuacagaacuuugu
miRNA Species Homo sapiens
Regulation Mechanism miR-148a directly targets ALCAM 3'UTR and decreases ALCAM expression. [4]
Evidence Score (E-score) 1 +
1 Luciferase Reporter Assay; Western Blot [4]
Representative Target(s) Regulated by This miRNA Activated leukocyte cell adhesionmolecule (ALCAM) Target Info
CD166_HUMAN
Activin receptor-like kinase 2 (ALK-2) Target Info
ACVR1_HUMAN
miRNA Mature ID hsa-miR-148b-3p miRNA Info
miRNA Mature AC
MIMAT0000759
Sequence ucagugcaucacagaacuuugu
miRNA Species Homo sapiens
Regulation Mechanism miR-148b directly targets ALCAM and is downregulated by miR-214 in melanoma. [5]
Evidence Score (E-score) 1 +
1 Luciferase Reporter Assay; Western Blot [5]
Representative Target(s) Regulated by This miRNA Activated leukocyte cell adhesionmolecule (ALCAM) Target Info
CD166_HUMAN
Activin receptor-like kinase 2 (ALK-2) Target Info
ACVR1_HUMAN
miRNA Mature ID hsa-miR-152-3p miRNA Info
miRNA Mature AC
MIMAT0000438
Sequence ucagugcaugacagaacuugg
miRNA Species Homo sapiens
Regulation Mechanism miR-152 directly targets ALCAM 3'UTR and decreases ALCAM expression. [4]
Evidence Score (E-score) 1 +
1 Luciferase Reporter Assay; Western Blot [4]
Representative Target(s) Regulated by This miRNA Activated leukocyte cell adhesionmolecule (ALCAM) Target Info
CD166_HUMAN
Dickkopf-related protein 1 (DKK1) Target Info
DKK1_HUMAN
miRNA Mature ID hsa-miR-483-5p miRNA Info
miRNA Mature AC
MIMAT0004761
Sequence aagacgggaggaaagaagggag
miRNA Species Homo sapiens
Regulation Mechanism miR-483-5p repressed UTR of ALCAM. [6]
Evidence Score (E-score) 1 +
1 Luciferase Reporter Assay [6]
Representative Target(s) Regulated by This miRNA Activated leukocyte cell adhesionmolecule (ALCAM) Target Info
CD166_HUMAN
Extracellular signal-regulated kinase 1 (ERK1) Target Info
MK03_HUMAN
References  Top
REF 1 MicroRNA-192 and -215 are upregulated in human gastric cancer in vivo and suppress ALCAM expression in vitro. Oncogene. 2011 Mar 31;30(13):1577-85.
REF 2 A limited set of human MicroRNA is deregulated in follicular thyroid carcinoma. J Clin Endocrinol Metab. 2006 Sep;91(9):3584-91.
REF 3 Coordinated regulation of cell cycle transcripts by p53-Inducible microRNAs, miR-192 and miR-215. Cancer Res. 2008 Dec 15;68(24):10105-12.
REF 4 MiR-148a and miR-152 reduce tamoxifen resistance in ER+ breast cancer via downregulating ALCAM. Biochem Biophys Res Commun. 2017 Feb 5;483(2):840-846.
REF 5 miR-214 coordinates melanoma progression by upregulating ALCAM through TFAP2 and miR-148b downmodulation. Cancer Res. 2013 Jul 1;73(13):4098-111.
REF 6 miR-483-5p promotes invasion and metastasis of lung adenocarcinoma by targeting RhoGDI1 and ALCAM. Cancer Res. 2014 Jun 1;74(11):3031-42.

If You Find Any Error in Data or Bug in Web Service, Please Kindly Report It to Dr. Zhou and Dr. Zhang.