Target Regulator(s) Information (MicroRNA)

Content Navigation (  All   None )                                      
Target General Information
The microRNAs (miRNAs) Regulating This Target
References
Target General Information  Top
Target ID T75570 Target Info
Target Name Yes tyrosine kinase (YES)
Synonyms p61-Yes; Yes p59-Fyn; Yes Protooncogene Syn; Tyrosine-protein kinase Yes; Proto-oncogene c-Yes
Target Type Clinical trial Target
Gene Name YES1
Biochemical Class Kinase
UniProt ID
P07947
The microRNAs (miRNAs) Regulating This Target  Top
miRNA Mature ID hsa-miR-145-5p miRNA Info
miRNA Mature AC
MIMAT0000437
Sequence guccaguuuucccaggaaucccu
miRNA Species Homo sapiens
Regulation Mechanism Overexpression of miR-145 resulted in decreased luciferase activity, indicating that the miRNA can bind the YES 3'UTR. [1]
Evidence Score (E-score) 2 +
1 Luciferase Reporter Assay; Western Blot [1]
2 Reporter Assay; Microarray [2]
Representative Target(s) Regulated by This miRNA A proliferation-inducing ligand (APRIL) Target Info
TNF13_HUMAN
Alkaline phosphatase (ALPPL2) Target Info
PPBN_HUMAN
miRNA Mature ID hsa-miR-17-5p miRNA Info
miRNA Mature AC
MIMAT0000070
Sequence caaagugcuuacagugcagguag
miRNA Species Homo sapiens
Regulation Mechanism YES1 is a direct target gene of miR-17-5p and miR-17-5p upregulate YES1 expression. [3]
Evidence Score (E-score) 2 +
1 Luciferase Reporter Assay [3]
2 qRT-PCR; Luciferase Reporter Assay; Western Blot [4]
Representative Target(s) Regulated by This miRNA Amyloid beta A4 protein (APP) Target Info
A4_HUMAN
Apoptosis mediating surface antigen FAS (FAS) Target Info
TNR6_HUMAN
miRNA Mature ID hsa-miR-205-5p miRNA Info
miRNA Mature AC
MIMAT0000266
Sequence uccuucauuccaccggagucug
miRNA Species Homo sapiens
Evidence Score (E-score) 1 +
1 Reporter Assay [5]
Representative Target(s) Regulated by This miRNA Androgen receptor (AR) Target Info
ANDR_HUMAN
Apoptosis regulator Bcl-2 (BCL-2) Target Info
BCL2_HUMAN
References  Top
REF 1 MicroRNA-145 targets YES and STAT1 in colon cancer cells. PLoS One. 2010 Jan 21;5(1):e8836.
REF 2 miR-145, miR-133a and miR-133b: Tumor-suppressive miRNAs target FSCN1 in esophageal squamous cell carcinoma. Int J Cancer. 2010 Dec 15;127(12):2804-14.
REF 3 A high throughput experimental approach to identify miRNA targets in human cells. Nucleic Acids Res. 2009 Nov;37(20):e137.
REF 4 MiR-17-5p up-regulates YES1 to modulate the cell cycle progression and apoptosis in ovarian cancer cell lines. J Cell Biochem. 2015 Jun;116(6):1050-9.
REF 5 MicroRNA-205 inhibits Src-mediated oncogenic pathways in renal cancer. Cancer Res. 2011 Apr 1;71(7):2611-21.

If You Find Any Error in Data or Bug in Web Service, Please Kindly Report It to Dr. Zhou and Dr. Zhang.