Target Regulator(s) Information (MicroRNA)

Content Navigation (  All   None )                                      
Target General Information
The microRNAs (miRNAs) Regulating This Target
References
Target General Information  Top
Target ID T80423 Target Info
Target Name von Hippel-Lindau disease tumor suppressor (VHL)
Synonyms pVHL; Protein G7
Target Type Patented-recorded Target
Gene Name VHL
UniProt ID
P40337
The microRNAs (miRNAs) Regulating This Target  Top
miRNA Mature ID hsa-miR-155-5p miRNA Info
miRNA Mature AC
MIMAT0000646
Sequence uuaaugcuaaucgugauagggguu
miRNA Species Homo sapiens
Regulation Mechanism Expression of VHL rescues miR-155-induced angiogenesis in vitro and in vivo. [2]
Evidence Score (E-score) 2 +
1 Literature Reported [1]
2 Luciferase Reporter Assay [2]
Representative Target(s) Regulated by This miRNA Acetyl-CoA transporter (SLC33A1) Target Info
ACATN_HUMAN
Angiotensin II receptor type-1 (AGTR1) Target Info
AGTR1_HUMAN
miRNA Mature ID hsa-miR-21-5p miRNA Info
miRNA Mature AC
MIMAT0000076
Sequence uagcuuaucagacugauguuga
miRNA Species Homo sapiens
Regulation Mechanism VHL is targeted by miR-21. [3]
Evidence Score (E-score) 1 +
1 Luciferase Reporter Assay; Western Blot [3]
Representative Target(s) Regulated by This miRNA Apoptosis antigen ligand (CD178) Target Info
TNFL6_HUMAN
Apoptosis regulator Bcl-2 (BCL-2) Target Info
BCL2_HUMAN
miRNA Mature ID hsa-miR-23b-3p miRNA Info
miRNA Mature AC
MIMAT0000418
Sequence aucacauugccagggauuaccac
miRNA Species Homo sapiens
Regulation Mechanism The seed sequence of miR-23b matched the 3-UTR of the VHL gene. [4]
Evidence Score (E-score) 1 +
1 Luciferase Reporter Assay [4]
Representative Target(s) Regulated by This miRNA Activin receptor type IIB (ACVR2B) Target Info
AVR2B_HUMAN
Carbonic anhydrase II (CA-II) Target Info
CAH2_HUMAN
References  Top
REF 1 MiR-155 at the heart of oncogenic pathways. Oncogene. 2014 Feb 6;33(6):677-8.
REF 2 Upregulation of miRNA-155 promotes tumour angiogenesis by targeting VHL and is associated with poor prognosis and triple-negative breast cancer. Oncogene. 2014 Feb 6;33(6):679-89.
REF 3 Blockage of a miR-21/EGFR regulatory feedback loop augments anti-EGFR therapy in glioblastomas. Cancer Lett. 2014 Jan 1;342(1):139-49.
REF 4 VHL regulates the effects of miR-23b on glioma survival and invasion via suppression of HIF-1/VEGF and -catenin/Tcf-4 signaling. Neuro Oncol. 2012 Aug;14(8):1026-36.

If You Find Any Error in Data or Bug in Web Service, Please Kindly Report It to Dr. Zhou and Dr. Zhang.