Target Regulator(s) Information (MicroRNA)

Content Navigation (  All   None )                                      
Target General Information
The microRNAs (miRNAs) Regulating This Target
References
Target General Information  Top
Target ID T81240 Target Info
Target Name E3 ubiquitin protein ligase Itchy (ITCH)
Synonyms NFE2-associated polypeptide 1; NAPP1; Itch; HECT-type E3 ubiquitin transferase Itchy homolog; E3 ubiquitin-protein ligase Itchy homolog; Atrophin-1-interacting protein 4; AIP4
Target Type Literature-reported Target
Gene Name ITCH
Biochemical Class Acyltransferase
UniProt ID
Q96J02
The microRNAs (miRNAs) Regulating This Target  Top
miRNA Mature ID hsa-miR-106b-5p miRNA Info
miRNA Mature AC
MIMAT0000680
Sequence uaaagugcugacagugcagau
miRNA Species Homo sapiens
Regulation Mechanism The overexpression of miR-106b-5p by mature miRNA precursor transfection resulted in the decreased protein level of target ITCH. [2]
Evidence Score (E-score) 3 +
Representative Target(s) Regulated by This miRNA Amyloid beta A4 protein (APP) Target Info
A4_HUMAN
Apoptosis mediating surface antigen FAS (FAS) Target Info
TNR6_HUMAN
miRNA Mature ID hsa-miR-214-5p miRNA Info
miRNA Mature AC
MIMAT0004564
Sequence ugccugucuacacuugcugugc
miRNA Species Homo sapiens
Regulation Mechanism miR-214 targeted the 3'UTR of ITCH. ITCH expression levels were significantly reduced by the miR-214 mimic and slightly upregulated by the miR-214 inhibitor, which indicated that ITCH was a target gene of miR-214. [4]
Evidence Score (E-score) 1 +
Representative Target(s) Regulated by This miRNA Cellular tumor antigen p53 (TP53) Target Info
P53_HUMAN
Cyclin-dependent kinase 3 (CDK3) Target Info
CDK3_HUMAN
References  Top
REF 1 Negative correlation of ITCH E3 ubiquitin ligase and miRNA-106b dictates metastatic progression in pancreatic cancer. Oncotarget. 2016 Jan 12;7(2):1477-85.
REF 2 MicroRNA-regulated pathways associated with endometriosis. Mol Endocrinol. 2009 Feb;23(2):265-75.
REF 3 Specific activation of microRNA106b enables the p73 apoptotic response in chronic lymphocytic leukemia by targeting the ubiquitin ligase Itch for degradation. Blood. 2009 Apr 16;113(16):3744-53.
REF 4 Upregulated microRNA-214 enhances cardiac injury by targeting ITCH during coxsackievirus infection. Mol Med Rep. 2015 Jul;12(1):1258-64.

If You Find Any Error in Data or Bug in Web Service, Please Kindly Report It to Dr. Zhou and Dr. Zhang.