Target Regulator(s) Information (MicroRNA)

Content Navigation (  All   None )                                      
Target General Information
The microRNAs (miRNAs) Regulating This Target
References
Target General Information  Top
Target ID T85435 Target Info
Target Name Insulin receptor (INSR)
Synonyms IR; CD220 antigen; CD220
Target Type Successful Target
Gene Name INSR
Biochemical Class Kinase
UniProt ID
P06213
The microRNAs (miRNAs) Regulating This Target  Top
miRNA Mature ID hsa-miR-15b-5p miRNA Info
miRNA Mature AC
MIMAT0000417
Sequence uagcagcacaucaugguuuaca
miRNA Species Homo sapiens
Regulation Mechanism Overexpression of miR-15b suppressed the protein expression of INSR through targeting INSR 3'untranslated region directly,. [1]
Evidence Score (E-score) 2 +
1 Luciferase Reporter Assay; Western Blot [1]
2 qPCR [2]
Representative Target(s) Regulated by This miRNA Apoptosis regulator Bcl-2 (BCL-2) Target Info
BCL2_HUMAN
Checkpoint kinase-1 (CHK1) Target Info
CHK1_HUMAN
miRNA Mature ID hsa-miR-195-5p miRNA Info
miRNA Mature AC
MIMAT0000461
Sequence uagcagcacagaaauauuggc
miRNA Species Homo sapiens
Regulation Mechanism The transfection with miR-195 mimic in the presence of the INSR 3'UTR wt construct resulted in a significant decrease in luciferase activity compared to its mutant counterpart INSR 3'UTR mut. [3]
Evidence Score (E-score) 1 +
1 Luciferase Reporter Assay; Western Blot [3]
Representative Target(s) Regulated by This miRNA ADP-ribosylation factor-like protein 2 (ARL2) Target Info
ARL2_HUMAN
Apoptosis inhibitor survivin (BIRC5) Target Info
BIRC5_HUMAN
References  Top
REF 1 Obesity-induced miR-15b is linked causally to the development of insulin resistance through the repression of the insulin receptor in hepatocytes. Mol Nutr Food Res. 2015 Nov;59(11):2303-14.
REF 2 MiR-15b can target insulin receptor to regulate hepatic insulin signaling in mice. Anim Cells Syst (Seoul). 2019 Feb 27;23(2):82-89.
REF 3 Saturated fatty acid-induced miR-195 impairs insulin signaling and glycogen metabolism in HepG2 cells. FEBS Lett. 2014 Nov 3;588(21):3939-46.

If You Find Any Error in Data or Bug in Web Service, Please Kindly Report It to Dr. Zhou and Dr. Zhang.