Content Navigation
( All
None )
| Target General Information |
Top |
| Target ID |
T86014 |
Target Info
|
| Target Name |
Sphingosine kinase 1 (SPHK1) |
| Synonyms |
SPK 1; SPK; SPHK1; SK 1; Acetyltransferase SPHK1 |
| Target Type |
Clinical trial Target |
| Gene Name |
SPHK1 |
| Biochemical Class |
Kinase |
| UniProt ID |
|
| The microRNAs (miRNAs) Regulating This Target |
Top |
| miRNA Mature ID |
hsa-miR-506-3p |
miRNA Info
|
| miRNA Mature AC |
|
| Sequence |
uaaggcacccuucugaguaga
|
| miRNA Species |
Homo sapiens |
| Regulation Mechanism |
miR-506 depresses the angiogenesis of liver cancer through targeting 3'UTR of SPHK1 mRNA. |
[2] |
| Evidence Score (E-score) |
2 |
+ |
| 1 |
Luciferase Reporter Assay; qRT-PCR; Western Blot |
[1] |
| 2 |
Luciferase Reporter Assay; Western Blot |
[2] |
| Representative Target(s) Regulated by This miRNA |
Cyclin-dependent kinase 4 (CDK4)
|
Target Info
|
|
|
Cyclin-dependent kinase 6 (CDK6)
|
Target Info
|
|
| miRNA Mature ID |
hsa-miR-659-3p |
miRNA Info
|
| miRNA Mature AC |
|
| Sequence |
cuugguucagggagggucccca
|
| miRNA Species |
Homo sapiens |
| Evidence Score (E-score) |
1 |
+ |
| 1 |
Luciferase Reporter Assay; Western Blot |
[3] |
| Representative Target(s) Regulated by This miRNA |
Granulin (GRN)
|
Target Info
|
|
|
Sphingosine kinase 1 (SPHK1)
|
Target Info
|
|
| References |
Top |
| REF 1 |
Downregulated miR-506 expression facilitates pancreatic cancer progression and chemoresistance via SPHK1/Akt/NF-B signaling. Oncogene. 2016 Oct 20;35(42):5501-5514.
|
| REF 2 |
MiR-506 suppresses liver cancer angiogenesis through targeting sphingosine kinase 1 (SPHK1) mRNA. Biochem Biophys Res Commun. 2015 Dec 4-11;468(1-2):8-13.
|
| REF 3 |
miR-659-3p is involved in the regulation of the chemotherapy response of colorectal cancer via modulating the expression of SPHK1. Am J Cancer Res. 2016 Sep 1;6(9):1976-1985.
|
If You Find Any Error in Data or Bug in Web Service, Please Kindly Report It to Dr. Zhou and Dr. Zhang.
