Content Navigation
( All
None )
| Target General Information |
Top |
| Target ID |
T93848 |
Target Info
|
| Target Name |
Melanoma-associated antigen 2 (MAGEA2) |
| Synonyms |
MAGEA2B; MAGEA2A; MAGE2; MAGE-2 antigen; Cancer/testis antigen 1.2; CT1.2 |
| Target Type |
Literature-reported Target |
| Gene Name |
MAGEA2 |
| UniProt ID |
|
| The microRNAs (miRNAs) Regulating This Target |
Top |
| miRNA Mature ID |
hsa-miR-34a-5p |
miRNA Info
|
| miRNA Mature AC |
|
| Sequence |
uggcagugucuuagcugguugu
|
| miRNA Species |
Homo sapiens |
| Regulation Mechanism |
MAGE-A2 is a direct target for miR-34a. |
[2] |
| Evidence Score (E-score) |
2 |
+ |
| 1 |
Luciferase Report Assay; Western Blot |
[1] |
| 2 |
Luciferase Reporter Assay; Western Blot |
[2] |
| Representative Target(s) Regulated by This miRNA |
Amphiregulin (AREG)
|
Target Info
|
|
|
Androgen receptor (AR)
|
Target Info
|
|
| References |
Top |
| REF 1 |
miR 34a regulates the chemosensitivity of retinoblastoma cells via modulation of MAGE A/p53 signaling. Int J Oncol. 2019 Jan;54(1):177-187.
|
| REF 2 |
miR-34a confers chemosensitivity through modulation of MAGE-A and p53 in medulloblastoma. Neuro Oncol. 2011 Feb;13(2):165-75.
|
If You Find Any Error in Data or Bug in Web Service, Please Kindly Report It to Dr. Zhou and Dr. Zhang.
