Target Regulator(s) Information (MicroRNA)

Content Navigation (  All   None )                                      
Target General Information
The microRNAs (miRNAs) Regulating This Target
References
Target General Information  Top
Target ID T97589 Target Info
Target Name Apoptosis signal-regulating kinase 1 (MAP3K5)
Synonyms Mitogen-activated protein kinase kinase kinase 5; MEKK5; MEKK 5; MEK kinase 5; MAPKKK5; MAPK/ERK kinase kinase 5; ASK1; ASK-1
Target Type Clinical trial Target
Gene Name MAP3K5
Biochemical Class Kinase
UniProt ID
Q99683
The microRNAs (miRNAs) Regulating This Target  Top
miRNA Mature ID hsa-miR-20a-5p miRNA Info
miRNA Mature AC
MIMAT0000075
Sequence uaaagugcuuauagugcagguag
miRNA Species Homo sapiens
Regulation Mechanism Ask1 is a direct target of miR-20a. Overexpression of miR-20a led to a global decrease in ASK1 protein in BLP- and LPS-activated cells indicating that miR-20a regulates the expression of ASK1 at the translational level. [2]
Evidence Score (E-score) 2 +
1 Luciferase Reporter Assay [1]
2 Luciferase Reporter Assay; Western Blot [2]
Representative Target(s) Regulated by This miRNA Amyloid beta A4 protein (APP) Target Info
A4_HUMAN
Apoptosis regulator Bcl-2 (BCL-2) Target Info
BCL2_HUMAN
miRNA Mature ID hsa-miR-19a-3p miRNA Info
miRNA Mature AC
MIMAT0000073
Sequence ugugcaaaucuaugcaaaacuga
miRNA Species Homo sapiens
Regulation Mechanism Overexpression of miR-19a markedly down regulated the activity of the luciferase gene fused with the wild-type ASK1 3'UTR. [3]
Evidence Score (E-score) 1 +
1 Luciferase Reporter Assay; Western Blot [3]
Representative Target(s) Regulated by This miRNA Adrenergic receptor beta-1 (ADRB1) Target Info
ADRB1_HUMAN
Apoptosis signal-regulating kinase 1 (MAP3K5) Target Info
M3K5_HUMAN
miRNA Mature ID hsa-miR-1224-3p miRNA Info
miRNA Mature AC
MIMAT0005459
Sequence ccccaccuccucucuccucag
miRNA Species Homo sapiens
Evidence Score (E-score) 1 +
1 Immunofluorescence [4]
Representative Target(s) Regulated by This miRNA ADAM metallopeptidase with thrombospondin 1 (ADAMTS1) Target Info
ATS1_HUMAN
Apoptosis signal-regulating kinase 1 (MAP3K5) Target Info
M3K5_HUMAN
miRNA Mature ID hsa-miR-301a-3p miRNA Info
miRNA Mature AC
MIMAT0000688
Sequence cagugcaauaguauugucaaagc
miRNA Species Homo sapiens
Regulation Mechanism miRNA-301a targets ASK1. [5]
Evidence Score (E-score) 1 +
1 Luciferase Reporter Assay; Western Blot [5]
Representative Target(s) Regulated by This miRNA Apoptosis signal-regulating kinase 1 (MAP3K5) Target Info
M3K5_HUMAN
Endothelial plasminogen activator inhibitor (SERPINE1) Target Info
PAI1_HUMAN
References  Top
REF 1 Knockdown of MiR-20a Enhances Sensitivity of Colorectal Cancer Cells to Cisplatin by Increasing ASK1 Expression. Cell Physiol Biochem. 2018;47(4):1432-1441.
REF 2 MiR-20a regulates ASK1 expression and TLR4-dependent cytokine release in rheumatoid fibroblast-like synoviocytes. Ann Rheum Dis. 2013 Jun;72(6):1071-9.
REF 3 MicroRNA-19a regulates lipopolysaccharide-induced endothelial cell apoptosis through modulation of apoptosis signal-regulating kinase 1 expression. BMC Mol Biol. 2015 May 16;16:11.
REF 4 Reorganization of metastamiRs in the evolution of metastatic aggressive neuroblastoma cells. BMC Genomics. 2015 Jul 7;16:501.
REF 5 MicroRNA-Mediated Down-Regulation of Apoptosis Signal-Regulating Kinase 1 (ASK1) Attenuates the Apoptosis of Human Mesenchymal Stem Cells (MSCs) Transplanted into Infarcted Heart. Int J Mol Sci. 2016 Oct 20;17(10). pii: E1752.

If You Find Any Error in Data or Bug in Web Service, Please Kindly Report It to Dr. Zhou and Dr. Zhang.