Target Regulator(s) Information (MicroRNA)

Content Navigation (  All   None )                                      
Target General Information
The microRNAs (miRNAs) Regulating This Target
References
Target General Information  Top
Target ID T98397 Target Info
Target Name Thymidylate synthase (TYMS)
Synonyms TSase; TS
Target Type Clinical trial Target
Gene Name TYMS
Biochemical Class Methyltransferase
UniProt ID
P04818
The microRNAs (miRNAs) Regulating This Target  Top
miRNA Mature ID hsa-miR-215-5p miRNA Info
miRNA Mature AC
MIMAT0000272
Sequence augaccuaugaauugacagac
miRNA Species Homo sapiens
Regulation Mechanism The overexpression of miR-215-5p resulted in the decreased protein level of target TYMS. [2]
Evidence Score (E-score) 2 +
1 Dual Luciferase Reporter Assay; Western Blot [1]
2 Western Blot; qRT-PCR; Luciferase Reporter Assay [2]
Representative Target(s) Regulated by This miRNA Activated leukocyte cell adhesionmolecule (ALCAM) Target Info
CD166_HUMAN
Activin receptor type IIB (ACVR2B) Target Info
AVR2B_HUMAN
miRNA Mature ID hsa-miR-193a-3p miRNA Info
miRNA Mature AC
MIMAT0000459
Sequence aacuggccuacaaagucccagu
miRNA Species Homo sapiens
Regulation Mechanism Transfection with miR-193a-3p resulted in decreased mRNA level of TYMS. [3]
Evidence Score (E-score) 1 +
1 qRT-PCR; Western Blot [3]
Representative Target(s) Regulated by This miRNA E2F transcription factor 1 (E2F1) Target Info
E2F1_HUMAN
Erbb2 tyrosine kinase receptor (HER2) Target Info
ERBB2_HUMAN
miRNA Mature ID hsa-miR-203a-3p miRNA Info
miRNA Mature AC
MIMAT0000264
Sequence gugaaauguuuaggaccacuag
miRNA Species Homo sapiens
Regulation Mechanism miR-203 suppresses TYMS expression via binding to its 3'UTR. [4]
Evidence Score (E-score) 1 +
1 Luciferase Reporter Assay; Western Blot [4]
Representative Target(s) Regulated by This miRNA Apoptosis inhibitor survivin (BIRC5) Target Info
BIRC5_HUMAN
Apoptosis regulator Bcl-W (BCL-W) Target Info
B2CL2_HUMAN
miRNA Mature ID hsa-miR-433-3p miRNA Info
miRNA Mature AC
MIMAT0001627
Sequence aucaugaugggcuccucggugu
miRNA Species Homo sapiens
Regulation Mechanism TYMS mRNA is repressive regulated by miR-433. [5]
Evidence Score (E-score) 1 +
1 Luciferase Reporter Assay; Western Blot [5]
Representative Target(s) Regulated by This miRNA cAMP-dependent chloride channel (CFTR) Target Info
CFTR_HUMAN
Cyclic AMP-responsive element-binding protein (CREB1) Target Info
CREB1_HUMAN
References  Top
REF 1 miR-192/miR-215 influence 5-fluorouracil resistance through cell cycle-mediated mechanisms complementary to its post-transcriptional thymidilate sy... Mol Cancer Ther. 2010 Aug;9(8):2265-75.
REF 2 Molecular mechanism of chemoresistance by miR-215 in osteosarcoma and colon cancer cells. Mol Cancer. 2010 Apr 30;9:96.
REF 3 miR-193a-3p is a potential tumor suppressor in malignant pleural mesothelioma. Oncotarget. 2015 Sep 15;6(27):23480-95.
REF 4 miR-203 enhances chemosensitivity to 5-fluorouracil by targeting thymidylate synthase in colorectal cancer. Oncol Rep. 2015 Feb;33(2):607-14.
REF 5 MicroRNA-433 negatively regulates the expression of thymidylate synthase (TYMS) responsible for 5-fluorouracil sensitivity in HeLa cells. BMC Cancer. 2013 Aug 2;13:369.

If You Find Any Error in Data or Bug in Web Service, Please Kindly Report It to Dr. Zhou and Dr. Zhang.