miRNA Details

miRNA General Information
miRNA Mature ID hsa-miR-93-5p
miRNA Stemloop AC MI0000095
miRNA Stemloop ID hsa-mir-93
Sequence caaagugcuguucgugcagguag
TTD Target(s) Regulated by This miRNA ATP-binding cassette transporter A1 (ABCA1) Successful Target Target Info [1]
Interleukin-8 (IL8) Successful Target Target Info [2]
Intercellular adhesion molecule ICAM-1 (ICAM1) Successful Target Target Info [3]
Transforming growth factor beta 1 (TGFB1) Successful Target Target Info [3]
Vascular endothelial growth factor A (VEGFA) Successful Target Target Info [4]
Monoglyceride lipase (MAGL) Clinical trial Target Target Info [5]
TGF-beta receptor type II (TGFBR2) Clinical trial Target Target Info [6]
Epiregulin (EREG) Clinical trial Target Target Info [5]
Glucose transporter type 4 (SLC2A4) Clinical trial Target Target Info [7]
Hypoxia-inducible factor 1 alpha (HIF-1A) Clinical trial Target Target Info [8]
E2F transcription factor 1 (E2F1) Clinical trial Target Target Info [9]
Tumor suppressor candidate 2 (TUSC2) Clinical trial Target Target Info [10]
Matrix metalloproteinase-3 (MMP-3) Patented-recorded Target Target Info [4]
Stress-activated protein kinase JNK2 (JNK2) Preclinical Target Target Info [11]
Angiogenin (ANG) Literature-reported Target Target Info [12]
Histone acetyltransferase KAT2B (KAT2B) Literature-reported Target Target Info [13]
Large tumor suppressor homolog 2 (LATS2) Literature-reported Target Target Info [14]
Phosphatase and tensin homolog (PTEN) Literature-reported Target Target Info [15]
Proto-oncogene c-Myc (MYC) Literature-reported Target Target Info [3]
Integrin beta-8 (ITGB8) Clinical trial Target Target Info [16]
Melanoma differentiation-associated protein 6 (CDKN1A) Literature-reported Target Target Info [17]
Protein(s) Regulated by This miRNA Autophagy-related protein 16-1 Regulated Protein
A16L1_HUMAN
[18]
Cdc42-interacting protein 4 Regulated Protein
CIP4_HUMAN
[5]
Ceramide synthase 2 Regulated Protein
CERS2_HUMAN
[20]
Disabled homolog 2 Regulated Protein
DAB2_HUMAN
[21]
E3 ubiquitin-protein ligase ZNRF3 Regulated Protein
ZNRF3_HUMAN
[22]
Forkhead box protein O3 Regulated Protein
FOXO3_HUMAN
[23]
Hepatocyte nuclear factor 3-alpha Regulated Protein
FOXA1_HUMAN
[24]
HLA class I histocompatibility antigen, alpha chain F Regulated Protein
HLAF_HUMAN
[3]
Max dimerization protein 1 Regulated Protein
MAD1_HUMAN
[5]
Methylsterol monooxygenase 1 Regulated Protein
MSMO1_HUMAN
[5]
Monocarboxylate transporter 9 Regulated Protein
MOT9_HUMAN
[5]
Neuronal PAS domain-containing protein 2 Regulated Protein
NPAS2_HUMAN
[5]
NF-kappa-B inhibitor alpha Regulated Protein
IKBA_HUMAN
[26]
PH domain leucine-rich repeat-containing protein phosphatase 2 Regulated Protein
PHLP2_HUMAN
[23]
Programmed cell death protein 4 Regulated Protein
PDCD4_HUMAN
[27]
Protein Wnt-2b Regulated Protein
WNT2B_HUMAN
[3]
Rab11 family-interacting protein 1 Regulated Protein
RFIP1_HUMAN
[28]
Rho-related GTP-binding protein RhoC Regulated Protein
RHOC_HUMAN
[29]
Ribosomal protein S6 kinase alpha-4 Regulated Protein
KS6A4_HUMAN
[30]
SAM and SH3 domain-containing protein 1 Regulated Protein
SASH1_HUMAN
[5]
Serine/threonine-protein kinase STK11 Regulated Protein
STK11_HUMAN
[31]
Sorting nexin-16 Regulated Protein
SNX16_HUMAN
[5]
Sorting nexin-9 Regulated Protein
SNX9_HUMAN
[5]
Transcriptional activator protein Pur-alpha Regulated Protein
PURA_HUMAN
[32]
Tumor protein p53-inducible nuclear protein 1 Regulated Protein
T53I1_HUMAN
[33]
Zinc finger and BTB domain-containing protein 4 Regulated Protein
ZBTB4_HUMAN
[34]
References
REF 1 Up-regulated miR-93 contributes to coronary atherosclerosis pathogenesis through targeting ABCA1. Int J Clin Exp Med. 2015 Jan 15;8(1):674-81.
REF 2 Expression of microRNA-93 and Interleukin-8 during Pseudomonas aeruginosa-mediated induction of proinflammatory responses. Am J Respir Cell Mol Biol. 2014 Jun;50(6):1144-55.
REF 3 Genome-wide analyses of radioresistance-associated miRNA expression profile in nasopharyngeal carcinoma using next generation deep sequencing. PLoS One. 2013 Dec 19;8(12):e84486.
REF 4 Down regulation of MiR-93 contributes to endometriosis through targeting MMP3 and VEGFA. Am J Cancer Res. 2015 Apr 15;5(5):1706-17.
REF 5 MicroRNA profiling in mucosal biopsies of eosinophilic esophagitis patients pre and post treatment with steroids and relationship with mRNA targets. PLoS One. 2012;7(7):e40676.
REF 6 Transcriptome-wide identification of RNA-binding protein and microRNA target sites by PAR-CLIP. Cell. 2010 Apr 2;141(1):129-41.
REF 7 miRNA-93 inhibits GLUT4 and is overexpressed in adipose tissue of polycystic ovary syndrome patients and women with insulin resistance. Diabetes. 2013 Jul;62(7):2278-86.
REF 8 EBV and human microRNAs co-target oncogenic and apoptotic viral and human genes during latency. EMBO J. 2012 May 2;31(9):2207-21.
REF 9 c-Myc-regulated microRNAs modulate E2F1 expression. Nature. 2005 Jun 9;435(7043):839-43.
REF 10 miR-93, miR-98, and miR-197 regulate expression of tumor suppressor gene FUS1. Mol Cancer Res. 2009 Aug;7(8):1234-43.
REF 11 MiR-205 silences MED1 in hypoxic primary human trophoblasts. FASEB J. 2010 Jun;24(6):2030-9.
REF 12 miR-409-3p inhibits HT1080 cell proliferation, vascularization and metastasis by targeting angiogenin. Cancer Lett. 2012 Oct 28;323(2):171-9.
REF 13 MicroRNAs regulate critical genes associated with multiple myeloma pathogenesis. Proc Natl Acad Sci U S A. 2008 Sep 2;105(35):12885-90.
REF 14 MiR-93 enhances angiogenesis and metastasis by targeting LATS2. Cell Cycle. 2012 Dec 1;11(23):4352-65.
REF 15 Involvement of microRNA-93, a new regulator of PTEN/Akt signaling pathway, in regulation of chemotherapeutic drug cisplatin chemosensitivity in ovarian cancer cells. FEBS Lett. 2012 May 7;586(9):1279-86.
REF 16 MicroRNA miR-93 promotes tumor growth and angiogenesis by targeting integrin-8. Oncogene. 2011 Feb 17;30(7):806-21.
REF 17 Programmed cell death 4 (PDCD4) is an important functional target of the microRNA miR-21 in breast cancer cells. J Biol Chem. 2008 Jan 11;283(2):1026-33.
REF 18 MIR106B and MIR93 prevent removal of bacteria from epithelial cells by disrupting ATG16L1-mediated autophagy.Gastroenterology. 2014 Jan;146(1):188-99.
REF 19 MicroRNA profiling in mucosal biopsies of eosinophilic esophagitis patients pre and post treatment with steroids and relationship with mRNA targets. PLoS One. 2012;7(7):e40676.
REF 20 Repression of the miR-93-enhanced sensitivity of bladder carcinoma to chemotherapy involves the regulation of LASS2.Onco Targets Ther. 2016 Mar 29;9:1813-22.
REF 21 miR-93-directed downregulation of DAB2 defines a novel oncogenic pathway in lung cancer.Oncogene. 2014 Aug 21;33(34):4307-15.
REF 22 ZNRF3 contributes to the growth of lung carcinoma via inhibiting Wnt/-catenin pathway and is regulated by miR-93.Tumour Biol. 2016 Mar;37(3):3051-7.
REF 23 miR-93 promotes cell proliferation in gliomas through activation of PI3K/Akt signaling pathway. Oncotarget. 2015 Apr 10;6(10):8286-99.
REF 24 MicroRNA-93 Promotes Epithelial-Mesenchymal Transition of Endometrial Carcinoma Cells.PLoS One. 2016 Nov 9;11(11):e0165776.
REF 25 Genome-wide analyses of radioresistance-associated miRNA expression profile in nasopharyngeal carcinoma using next generation deep sequencing. PLoS One. 2013 Dec 19;8(12):e84486.
REF 26 Bioinformatic analysis of microRNA and mRNA Regulation in peripheral blood mononuclear cells of patients with chronic obstructive pulmonary disease.Respir Res. 2017 Jan 5;18(1):4.
REF 27 miR-93 functions as an oncomiR for the downregulation of PDCD4 in gastric carcinoma.Sci Rep. 2016 Mar 29;6:23772.
REF 28 Micro ribonucleic acid-93 promotes oncogenesis of cervical cancer by targeting RAB11 family interacting protein 1.J Obstet Gynaecol Res. 2016 Sep;42(9):1168-79.
REF 29 RhoC is a major target of microRNA-93-5P in epithelial ovarian carcinoma tumorigenesis and progression.Mol Cancer. 2015 Feb 4;14:31.
REF 30 miR-93 regulates Msk2-mediated chromatin remodelling in diabetic nephropathy.Nat Commun. 2016 Jun 28;7:12076.
REF 31 MiR-93 Promotes Tumorigenesis and Metastasis of Non-Small Cell Lung Cancer Cells by Activating the PI3K/Akt Pathway via Inhibition of LKB1/PTEN/CDKN1A.J Cancer. 2017 Mar 7;8(5):870-879.
REF 32 Translation of Pur- is targeted by cellular miRNAs to modulate the differentiation-dependent susceptibility of monocytes to HIV-1 infection.FASEB J. 2012 Nov;26(11):4755-64.
REF 33 Roles for microRNAs, miR-93 and miR-130b, and tumor protein 53-induced nuclear protein 1 tumor suppressor in cell growth dysregulation by human T-cell lymphotrophic virus 1.Cancer Res. 2008 Nov 1;68(21):8976-85.
REF 34 Induction of the transcriptional repressor ZBTB4 in prostate cancer cells by drug-induced targeting of microRNA-17-92/106b-25 clusters.Mol Cancer Ther. 2012 Sep;11(9):1852-62.

If You Find Any Error in Data or Bug in Web Service, Please Kindly Report It to Dr. Zhou and Dr. Zhang.