Target Regulator(s) Information (MicroRNA)

Content Navigation (  All   None )                                      
Target General Information
The microRNAs (miRNAs) Regulating This Target
References
Target General Information  Top
Target ID T09439 Target Info
Target Name Osteonectin (SPARC)
Synonyms Secreted protein acidic and rich in cysteine; ON; Basement-membrane protein 40; Basement membrane protein BM-40; BM-40
Target Type Literature-reported Target
Gene Name SPARC
UniProt ID
P09486
The microRNAs (miRNAs) Regulating This Target  Top
miRNA Mature ID hsa-miR-29a-3p miRNA Info
miRNA Mature AC
MIMAT0000086
Sequence uagcaccaucugaaaucgguua
miRNA Species Homo sapiens
Evidence Score (E-score) 4 +
1 Luciferase Reporter Assay [1]
2 Luciferase Reporter Assay [2]
3 Luciferase Reporter Assay; Microarray; Northern Blot; qRT-PCR; Western Blot [3]
4 Luciferase Reporter Assay; qRT-PCR; Western Blot [4]
Representative Target(s) Regulated by This miRNA Apoptosis regulator Bcl-2 (BCL-2) Target Info
BCL2_HUMAN
Aryl hydrocarbon receptor (AHR) Target Info
AHR_HUMAN
miRNA Mature ID hsa-miR-29c-3p miRNA Info
miRNA Mature AC
MIMAT0000681
Sequence uagcaccauuugaaaucgguua
miRNA Species Homo sapiens
Regulation Mechanism Introduction of mir-29c down-regulated SPARC at the level of mRNA and inhibited expression of luciferase encoded by vectors having the 3'UTR of SPARC. [2]
Evidence Score (E-score) 3 +
1 Immunohistochemistry; qRT-PCR [5]
2 Luciferase Reporter Assay [1]
3 Luciferase Reporter Assay [2]
Representative Target(s) Regulated by This miRNA Apoptosis regulator Bcl-2 (BCL-2) Target Info
BCL2_HUMAN
B7 homolog 3 (CD276) Target Info
CD276_HUMAN
miRNA Mature ID hsa-miR-204-5p miRNA Info
miRNA Mature AC
MIMAT0000265
Sequence uucccuuugucauccuaugccu
miRNA Species Homo sapiens
Regulation Mechanism The overexpression of miR-204-5p by mature miRNA transfection resulted in the changed mRNA level of target SPARC. [2]
Evidence Score (E-score) 2 +
1 qRT-PCR [2]
2 Western Blot [6]
Representative Target(s) Regulated by This miRNA Alkaline phosphatase tissue-nonspecific (ALPL) Target Info
PPBT_HUMAN
Apoptosis regulator Bcl-2 (BCL-2) Target Info
BCL2_HUMAN
miRNA Mature ID hsa-miR-211-5p miRNA Info
miRNA Mature AC
MIMAT0000268
Sequence uucccuuugucauccuucgccu
miRNA Species Homo sapiens
Regulation Mechanism Loss of miR-211 expression leads to SPARC overexpression. [7]
Evidence Score (E-score) 1 +
1 Immunohistochemistry; Luciferase Reporter Assay; Western Blot [7]
Representative Target(s) Regulated by This miRNA Apoptosis regulator Bcl-2 (BCL-2) Target Info
BCL2_HUMAN
Calcium-activated potassium channel KCa1.1 (KCNMA1) Target Info
KCMA1_HUMAN
miRNA Mature ID hsa-miR-29a-5p miRNA Info
miRNA Mature AC
MIMAT0004503
Sequence acugauuucuuuugguguucag
miRNA Species Homo sapiens
Regulation Mechanism Reporter assays revealed that miR-29b specifically suppressed the luciferase activity driven by the 3'UTR of COL3A1 mRNA, and mutating the miR-29b target sites in the 3'UTR abrogated miR-29b-induced inhibition of luciferase expression, demonstrating that mRNA of COL3A1 is a direct target of miR-29b. [8]
Evidence Score (E-score) 1 +
1 Western Blot [8]
Representative Target(s) Regulated by This miRNA Dickkopf-related protein 1 (DKK1) Target Info
DKK1_HUMAN
Glycogen synthase kinase-3 beta (GSK-3B) Target Info
GSK3B_HUMAN
miRNA Mature ID hsa-miR-767-5p miRNA Info
miRNA Mature AC
MIMAT0003882
Sequence ugcaccaugguugucugagcaug
miRNA Species Homo sapiens
Evidence Score (E-score) 1 +
1 Luciferase Reporter Assay [1]
Representative Target(s) Regulated by This miRNA Lysyl oxidase (LOX) Target Info
LYOX_HUMAN
Matrix metalloproteinase-2 (MMP-2) Target Info
MMP2_HUMAN
miRNA Mature ID hsa-miR-433-5p miRNA Info
miRNA Mature AC
MIMAT0026554
Sequence uacggugagccugucauuauuc
miRNA Species Homo sapiens
Regulation Mechanism A Single Nucleotide Polymorphism in Osteonectin 3'UTR Regulates Bone Volume and Is Targeted by miR433. [9]
Evidence Score (E-score) 1 +
1 Luciferase Reporter Assay; Western Blot [9]
Representative Target(s) Regulated by This miRNA Osteonectin (SPARC) Target Info
SPRC_HUMAN
References  Top
REF 1 A miRNA-regulatory network explains how dysregulated miRNAs perturb oncogenic processes across diverse cancers. Genome Res. 2012 Nov;22(11):2302-14.
REF 2 MicroRNA 29c is down-regulated in nasopharyngeal carcinomas, up-regulating mRNAs encoding extracellular matrix proteins. Proc Natl Acad Sci U S A. 2008 Apr 15;105(15):5874-8.
REF 3 Integrative nucleophosmin mutation-associated microRNA and gene expression pattern analysis identifies novel microRNA - target gene interactions in acute myeloid leukemia. Haematologica. 2011 Dec;96(12):1783-91.
REF 4 microRNA-29a suppresses cell proliferation by targeting SPARC in hepatocellular carcinoma. Int J Mol Med. 2012 Dec;30(6):1321-6.
REF 5 Micro-RNA signature of the epithelial-mesenchymal transition in endometrial carcinosarcoma. J Pathol. 2011 Jan;223(1):72-80.
REF 6 Identification of genes involved in glaucoma pathogenesis using combined network analysis and empirical studies. Hum Mol Genet. 2019 Sep 13. pii: ddz222.
REF 7 MiRNA-211 suppresses cell proliferation, migration and invasion by targeting SPARC in human hepatocellular carcinoma. Sci Rep. 2016 May 27;6:26679.
REF 8 miR-29a/b enhances cell migration and invasion in nasopharyngeal carcinoma progression by regulating SPARC and COL3A1 gene expression. PLoS One. 2015 Mar 18;10(3):e0120969.
REF 9 A single nucleotide polymorphism in osteonectin 3' untranslated region regulates bone volume and is targeted by miR-433. J Bone Miner Res. 2015 Apr;30(4):723-32.

If You Find Any Error in Data or Bug in Web Service, Please Kindly Report It to Dr. Zhou and Dr. Zhang.