Target Regulator(s) Information (MicroRNA)
| Target General Information | Top | ||||
|---|---|---|---|---|---|
| Target ID | T11211 | Target Info | |||
| Target Name | Androgen receptor (AR) | ||||
| Synonyms | Testosterone receptor; Nuclear receptor subfamily 3 group C member 4; NR3C4; Dihydrotestosterone receptor; DHTR | ||||
| Target Type | Successful Target | ||||
| Gene Name | AR | ||||
| Biochemical Class | Nuclear hormone receptor | ||||
| UniProt ID | |||||
| The microRNAs (miRNAs) Regulating This Target | Top | ||||
|---|---|---|---|---|---|
| miRNA Mature ID | hsa-miR-185-5p | miRNA Info | |||
| miRNA Mature AC | |||||
| Sequence | uggagagaaaggcaguuccuga | ||||
| miRNA Species | Homo sapiens | ||||
| Regulation Mechanism | 3'UTR of AR is a target of miR-185, and the binding site in the 3'UTR was responsible for the regulatory effect of miR-185 on AR and its biological functions. | [1] | |||
| Evidence Score (E-score) | 2 | + | |||
| 1 | Luciferase Reporter Assay | [1] | |||
| 2 | Luciferase Reporter Assay | [2] | |||
| Representative Target(s) Regulated by This miRNA | Androgen receptor (AR) | Target Info | |||
| Arachidonate 12-lipoxygenase (12-LOX) | Target Info | ||||
| miRNA Mature ID | hsa-miR-205-5p | miRNA Info | |||
| miRNA Mature AC | |||||
| Sequence | uccuucauuccaccggagucug | ||||
| miRNA Species | Homo sapiens | ||||
| Regulation Mechanism | miR-205 can regulate the AR expression level by binding to this part of the 3'UTR. | [3] | |||
| Evidence Score (E-score) | 2 | + | |||
| 1 | Immunoprecipitation; In Situ Hybridization; Luciferase Reporter Assay; qRT-PCR; Wetsern blot | [3] | |||
| 2 | Western Blot | [4] | |||
| Representative Target(s) Regulated by This miRNA | Androgen receptor (AR) | Target Info | |||
| Apoptosis regulator Bcl-2 (BCL-2) | Target Info | ||||
| miRNA Mature ID | hsa-miR-34a-5p | miRNA Info | |||
| miRNA Mature AC | |||||
| Sequence | uggcagugucuuagcugguugu | ||||
| miRNA Species | Homo sapiens | ||||
| Regulation Mechanism | Over-expression of miR-34a led to reduced expression of AR. | [6] | |||
| Evidence Score (E-score) | 2 | + | |||
| 1 | Luciferase Reporter Assay; Western Blot | [5] | |||
| 2 | qRT-PCR; Western Blot | [6] | |||
| Representative Target(s) Regulated by This miRNA | Amphiregulin (AREG) | Target Info | |||
| Androgen receptor (AR) | Target Info | ||||
| miRNA Mature ID | hsa-miR-488-5p | miRNA Info | |||
| miRNA Mature AC | |||||
| Sequence | cccagauaauggcacucucaa | ||||
| miRNA Species | Homo sapiens | ||||
| Regulation Mechanism | miR-488-5p negatively regulates AR expression by binding to the specific target site in 3' UTR of AR mRNA. | [7] | |||
| Evidence Score (E-score) | 1 | + | |||
| 1 | Luciferase Reporter Assay; Western Blot | [7] | |||
| Representative Target(s) Regulated by This miRNA | Androgen receptor (AR) | Target Info | |||
| References | Top | ||||
|---|---|---|---|---|---|
| REF 1 | MicroRNA-185 suppresses proliferation, invasion, migration, and tumorigenicity of human prostate cancer cells through targeting androgen receptor. Mol Cell Biochem. 2013 May;377(1-2):121-30. | ||||
| REF 2 | Systematic analysis of microRNAs targeting the androgen receptor in prostate cancer cells. Cancer Res. 2011 Mar 1;71(5):1956-67. | ||||
| REF 3 | miR-205 negatively regulates the androgen receptor and is associated with adverse outcome of prostate cancer patients. Br J Cancer. 2013 Apr 30;108(8):1668-76. | ||||
| REF 4 | MicroRNA-205 is associated with diabetes mellitus-induced erectile dysfunction via down-regulating the androgen receptor. J Cell Mol Med. 2019 May;23(5):3257-3270. | ||||
| REF 5 | Androgen receptor regulates ASS1P3/miR-34a-5p/ASS1 signaling to promote renal cell carcinoma cell growth. Cell Death Dis. 2019 Apr 18;10(5):339. | ||||
| REF 6 | Inactivation of AR and Notch-1 signaling by miR-34a attenuates prostate cancer aggressiveness. Am J Transl Res. 2012;4(4):432-42. | ||||
| REF 7 | miR 488* inhibits androgen receptor expression in prostate carcinoma cells. Int J Cancer. 2011 Aug 15;129(4):810-9. | ||||
If You Find Any Error in Data or Bug in Web Service, Please Kindly Report It to Dr. Zhou and Dr. Zhang.