The microRNAs (miRNAs) Regulating This Target |
Top |
miRNA Mature ID |
hsa-miR-142-3p |
miRNA Info
|
miRNA Mature AC |
|
Sequence |
uguaguguuuccuacuuuaugga
|
miRNA Species |
Homo sapiens |
Regulation Mechanism |
Cultures transfected with miR-142-3p mimic displayed reduced PKCA at the level of mRNA and protein. |
[2] |
Evidence Score (E-score) |
2 |
+ |
1 |
Luciferase Reporter Assay; Western Blot |
[1] |
2 |
Western Blot |
[2] |
Representative Target(s) Regulated by This miRNA |
ATP-binding cassette transporter G2 (ABCG2)
|
Target Info
|
|
High mobility group protein B1 (HMGB1)
|
Target Info
|
|
miRNA Mature ID |
hsa-miR-150-5p |
miRNA Info
|
miRNA Mature AC |
|
Sequence |
ucucccaacccuuguaccagug
|
miRNA Species |
Homo sapiens |
Regulation Mechanism |
Luciferase activity was significantly inhibited in cells transfected with wt-PRKCA-3'UTR compared with that in cells transfected with mut-PRKCA-3'UTR. |
[3] |
Evidence Score (E-score) |
2 |
+ |
1 |
Luciferase Reporter Assay |
[1] |
2 |
Luciferase Reporter Assay; Western Blot |
[3] |
Representative Target(s) Regulated by This miRNA |
Apoptosis inhibitor survivin (BIRC5)
|
Target Info
|
|
Beta-arrestin-2 (ARRB2)
|
Target Info
|
|
miRNA Mature ID |
hsa-miR-203a-3p |
miRNA Info
|
miRNA Mature AC |
|
Sequence |
gugaaauguuuaggaccacuag
|
miRNA Species |
Homo sapiens |
Evidence Score (E-score) |
1 |
+ |
1 |
qRT-PCR |
[4] |
Representative Target(s) Regulated by This miRNA |
Apoptosis inhibitor survivin (BIRC5)
|
Target Info
|
|
Apoptosis regulator Bcl-W (BCL-W)
|
Target Info
|
|