miRNA Details
| miRNA General Information | |||||
|---|---|---|---|---|---|
| miRNA Mature ID | hsa-miR-142-3p | ||||
| miRNA Stemloop AC | MI0000458 | ||||
| miRNA Stemloop ID | hsa-mir-142 | ||||
| Sequence | uguaguguuuccuacuuuaugga | ||||
| TTD Target(s) Regulated by This miRNA | ATP-binding cassette transporter G2 (ABCG2) | Successful Target | Target Info | [1] | |
| Interleukin-6 (IL6) | Successful Target | Target Info | [2] | ||
| Protein kinase C alpha (PRKCA) | Successful Target | Target Info | [3] | ||
| TGF-beta receptor type I (TGFBR1) | Clinical trial Target | Target Info | [4] | ||
| Rho-associated protein kinase 2 (ROCK2) | Successful Target | Target Info | [5] | ||
| Interleukin-1 alpha (IL1A) | Clinical trial Target | Target Info | [6] | ||
| Monoglyceride lipase (MAGL) | Clinical trial Target | Target Info | [7] | ||
| Prominin-1 (PROM1) | Clinical trial Target | Target Info | [8] | ||
| M-phase inducer phosphatase 3 (MPIP3) | Literature-reported Target | Target Info | [9] | ||
| Histone acetyltransferase KAT2B (KAT2B) | Literature-reported Target | Target Info | [10] | ||
| Ras-related C3 botulinum toxin substrate 1 (RAC1) | Literature-reported Target | Target Info | [11] | ||
| Leucine-rich repeat-containing GPCR 5 (LGR5) | Clinical trial Target | Target Info | [1] | ||
| High mobility group protein B1 (HMGB1) | Literature-reported Target | Target Info | [12] | ||
| High mobility group protein HMG-I/Y (HMGA1) | Literature-reported Target | Target Info | [7] | ||
| Homeobox protein Hox-A7 (HOXA7) | Literature-reported Target | Target Info | [13] | ||
| Protein(s) Regulated by This miRNA | Adenomatous polyposis coli protein | Regulated Protein | [14] | ||
| Aryl hydrocarbon receptor nuclear translocator-like protein 1 | Regulated Protein | [15] | |||
| Biorientation of chromosomes in cell division protein 1 | Regulated Protein | [16] | |||
| Coiled-coil domain-containing protein 6 | Regulated Protein | [10] | |||
| Cyclin-T2 | Regulated Protein | [18] | |||
| Dedicator of cytokinesis protein 6 | Regulated Protein | [19] | |||
| DNA repair protein XRCC1 | Regulated Protein | [20] | |||
| E3 SUMO-protein ligase EGR2 | Regulated Protein | [21] | |||
| E3 ubiquitin-protein ligase HECTD1 | Regulated Protein | [10] | |||
| Heat shock 70 kDa protein 1B | Regulated Protein | [22] | |||
| Homeobox protein Hox-A10 | Regulated Protein | [13] | |||
| Homeobox protein Hox-A9 | Regulated Protein | [13] | |||
| Lipoma-preferred partner | Regulated Protein | [24] | |||
| Neural Wiskott-Aldrich syndrome protein | Regulated Protein | [10] | |||
| Protein mono-ADP-ribosyltransferase TIPARP | Regulated Protein | [10] | |||
| Ras-related protein Rab-2A | Regulated Protein | [10] | |||
| SUN domain-containing ossification factor | Regulated Protein | [10] | |||
| TGF-beta-activated kinase 1 and MAP3K7-binding protein 2 | Regulated Protein | [18] | |||
| Thrombospondin-4 | Regulated Protein | [25] | |||
| Transforming growth factor beta activator LRRC32 | Regulated Protein | [26] | |||
| Twinfilin-1 | Regulated Protein | [10] | |||
| Tyrosine-protein phosphatase non-receptor type 23 | Regulated Protein | [27] | |||
| Uncharacterized protein C18orf25 | Regulated Protein | [10] | |||
| USP6 N-terminal-like protein | Regulated Protein | [10] | |||
| References | |||||
| REF 1 | MiR-142-3p functions as a tumor suppressor by targeting CD133, ABCG2, and Lgr5 in colon cancer cells. J Mol Med (Berl). 2013 Aug;91(8):989-1000. | ||||
| REF 2 | Targeting of microRNA-142-3p in dendritic cells regulates endotoxin-induced mortality. Blood. 2011 Jun 9;117(23):6172-83. | ||||
| REF 3 | MiR-142-3p is a RANKL-dependent inducer of cell death in osteoclasts. Sci Rep. 2016 Apr 26;6:24980. | ||||
| REF 4 | MicroRNA targeting specificity in mammals: determinants beyond seed pairing. Mol Cell. 2007 Jul 6;27(1):91-105. | ||||
| REF 5 | Elucidation of transcriptome-wide microRNA binding sites in human cardiac tissues by Ago2 HITS-CLIP. Nucleic Acids Res. 2016 Sep 6;44(15):7120-31. | ||||
| REF 6 | MicroRNA profiling of Epstein-Barr virus-associated NK/T-cell lymphomas by deep sequencing. PLoS One. 2012;7(8):e42193. | ||||
| REF 7 | EBV and human microRNAs co-target oncogenic and apoptotic viral and human genes during latency. EMBO J. 2012 May 2;31(9):2207-21. | ||||
| REF 8 | Combined characterization of microRNA and mRNA profiles delineates early differentiation pathways of CD133+ and CD34+ hematopoietic stem and progenitor cells. Stem Cells. 2011 May;29(5):847-57. | ||||
| REF 9 | miR-142-3p inhibits cancer cell proliferation by targeting CDC25C. Cell Prolif. 2016 Feb;49(1):58-68. | ||||
| REF 10 | MicroRNA profiling in mucosal biopsies of eosinophilic esophagitis patients pre and post treatment with steroids and relationship with mRNA targets. PLoS One. 2012;7(7):e40676. | ||||
| REF 11 | MicroRNA-142-3p, a new regulator of RAC1, suppresses the migration and invasion of hepatocellular carcinoma cells. FEBS Lett. 2011 May 6;585(9):1322-30. | ||||
| REF 12 | MiR-142-3p functions as a potential tumor suppressor directly targeting HMGB1 in non-small-cell lung carcinoma. Int J Clin Exp Pathol. 2015 Sep 1;8(9):10800-7. | ||||
| REF 13 | MicroRNA-142-3p inhibits cell proliferation in human acute lymphoblastic leukemia by targeting the MLL-AF4 oncogene. Mol Biol Rep. 2013 Dec;40(12):6811-9. | ||||
| REF 14 | miR-42p promotes osteoblast differentiation by modulating Wnt signaling.Mol Med Rep. 2013 Feb;7(2):689-93. | ||||
| REF 15 | Expression and rhythmic modulation of circulating microRNAs targeting the clock gene Bmal1 in mice.PLoS One. 2011;6(7):e22586. | ||||
| REF 16 | Radiation induces premature chromatid separation via the miR-142-3p/Bod1 pathway in carcinoma cells.Oncotarget. 2016 Sep 13;7(37):60432-60445. | ||||
| REF 17 | MicroRNA profiling in mucosal biopsies of eosinophilic esophagitis patients pre and post treatment with steroids and relationship with mRNA targets. PLoS One. 2012;7(7):e40676. | ||||
| REF 18 | MicroRNA-29a and microRNA-142-3p are regulators of myeloid differentiation and acute myeloid leukemia. Blood. 2012 May 24;119(21):4992-5004. | ||||
| REF 19 | miR-142-3p Is a Regulator of the TGF-Mediated Vascular Smooth Muscle Cell Phenotype.J Cell Biochem. 2015 Oct;116(10):2325-33. | ||||
| REF 20 | Oncogenic microRNA-142-3p is associated with cellular migration, proliferation and apoptosis in renal cell carcinoma. Oncol Lett. 2016 Feb;11(2):1235-1241. | ||||
| REF 21 | A role for miR-142-3p in colony-stimulating factor 1-induced monocyte differentiation into macrophages.Biochim Biophys Acta. 2013 Aug;1833(8):1936-46. | ||||
| REF 22 | Triptolide induces the expression of miR-142-3p: a negative regulator of heat shock protein 70 and pancreatic cancer cell proliferation.Mol Cancer Ther. 2013 Jul;12(7):1266-75. | ||||
| REF 23 | MicroRNA-142-3p inhibits cell proliferation in human acute lymphoblastic leukemia by targeting the MLL-AF4 oncogene. Mol Biol Rep. 2013 Dec;40(12):6811-9. | ||||
| REF 24 | miR-142-3p enhances FcRI-mediated degranulation in mast cells.Biochem Biophys Res Commun. 2014 Jan 17;443(3):980-6. | ||||
| REF 25 | Over-expression of Thrombospondin 4 correlates with loss of miR-142 and contributes to migration and vascular invasion of advanced hepatocellular carcinoma.Oncotarget. 2017 Apr 4;8(14):23277-23288. | ||||
| REF 26 | miR-142-3p is involved in CD25+ CD4 T cell proliferation by targeting the expression of glycoprotein A repetitions predominant.J Immunol. 2013 Jun 15;190(12):6579-88. | ||||
| REF 27 | Tumor-suppressive function of protein-tyrosine phosphatase non-receptor type 23 in testicular germ cell tumors is lost upon overexpression of miR142-3p microRNA.J Biol Chem. 2013 Aug 16;288(33):23990-9. | ||||
If You Find Any Error in Data or Bug in Web Service, Please Kindly Report It to Dr. Zhou and Dr. Zhang.