Target Regulator(s) Information (MicroRNA)

Content Navigation (  All   None )                                      
Target General Information
The microRNAs (miRNAs) Regulating This Target
References
Target General Information  Top
Target ID T13616 Target Info
Target Name Integrin-linked protein kinase 1 (ILK)
Synonyms P59ILK; Integrin-linked protein kinase; Integrin-linked kinase; ILK2; ILK1; ILK-2; ILK-1; Beta-integrin-linked kinase; 59 kDa serine/threonine-protein kinase; 59 kDa serine/threonine protein kinase
Target Type Patented-recorded Target
Gene Name ILK
Biochemical Class Kinase
UniProt ID
Q13418
The microRNAs (miRNAs) Regulating This Target  Top
miRNA Mature ID hsa-miR-542-3p miRNA Info
miRNA Mature AC
MIMAT0003389
Sequence ugugacagauugauaacugaaa
miRNA Species Homo sapiens
Regulation Mechanism miR-542-3p suppresses glioblastoma cell invasion through tar- geting the AKT pathway by directly inhibiting AKT1, ILK, and PIK3R1 simultaneously. [2]
Evidence Score (E-score) 2 +
1 Immunoblot; Immunocytochemistry; Luciferase Reporter Assay [1]
2 Immunohistochemistry; Luciferase Reporter Assay; Western Blot [2]
Representative Target(s) Regulated by This miRNA Angiopoietin-2 (ANGPT2) Target Info
ANGP2_HUMAN
Apoptosis inhibitor survivin (BIRC5) Target Info
BIRC5_HUMAN
miRNA Mature ID hsa-miR-145-5p miRNA Info
miRNA Mature AC
MIMAT0000437
Sequence guccaguuuucccaggaaucccu
miRNA Species Homo sapiens
Regulation Mechanism miR-145 targeted ilk. [3]
Evidence Score (E-score) 1 +
1 Luciferase Reporter Assay; Western Blot [3]
Representative Target(s) Regulated by This miRNA A proliferation-inducing ligand (APRIL) Target Info
TNF13_HUMAN
Alkaline phosphatase (ALPPL2) Target Info
PPBN_HUMAN
miRNA Mature ID hsa-miR-625-5p miRNA Info
miRNA Mature AC
MIMAT0003294
Sequence agggggaaaguucuauagucc
miRNA Species Homo sapiens
Regulation Mechanism ILK is a direct target gene for miR-625. [4]
Evidence Score (E-score) 1 +
1 Immunoblot; Immunohistochemistry; Luciferase Reporter Assay [4]
Representative Target(s) Regulated by This miRNA Fragile histidine triad protein (FHIT) Target Info
FHIT_HUMAN
High mobility group protein HMG-I/Y (HMGA1) Target Info
HMGA1_HUMAN
References  Top
REF 1 MicroRNA-mediated upregulation of integrin-linked kinase promotes Src-induced tumor progression. Oncogene. 2012 Mar 29;31(13):1623-35.
REF 2 MicroRNA-542-3p Suppresses Tumor Cell Invasion via Targeting AKT Pathway in Human Astrocytoma. J Biol Chem. 2015 Oct 9;290(41):24678-88.
REF 3 Replacement treatment with microRNA-143 and -145 induces synergistic inhibition of the growth of human bladder cancer cells by regulating PI3K/Akt and MAPK signaling pathways. Cancer Lett. 2013 Jan 28;328(2):353-61.
REF 4 Down-regulated miR-625 suppresses invasion and metastasis of gastric cancer by targeting ILK. FEBS Lett. 2012 Jul 30;586(16):2382-8.

If You Find Any Error in Data or Bug in Web Service, Please Kindly Report It to Dr. Zhou and Dr. Zhang.