Target Regulator(s) Information (MicroRNA)

Content Navigation (  All   None )                                      
Target General Information
The microRNAs (miRNAs) Regulating This Target
References
Target General Information  Top
Target ID T13726 Target Info
Target Name Retinoic acid receptor RXR-alpha (RXRA)
Synonyms Retinoid X receptor alpha; RXRalpha; Nuclear receptor subfamily 2 group B member 1; NR2B1
Target Type Successful Target
Gene Name RXRA
Biochemical Class Nuclear hormone receptor
UniProt ID
P19793
The microRNAs (miRNAs) Regulating This Target  Top
miRNA Mature ID hsa-miR-27a-3p miRNA Info
miRNA Mature AC
MIMAT0000084
Sequence uucacaguggcuaaguuccgc
miRNA Species Homo sapiens
Regulation Mechanism Luciferase assays also revealed a reduction in luciferase expression driven by the 3'UTR of RXRA, an effect that was abrogated by point mutations in the miR-27a interacting region of the 3'UTR of RXRA. [1]
Evidence Score (E-score) 2 +
1 Luciferase Reporter Assay [1]
2 Luciferase Reporter Assay; Western Blot [2]
Representative Target(s) Regulated by This miRNA ATP-binding cassette transporter A1 (ABCA1) Target Info
ABCA1_HUMAN
Cellular tumor antigen p53 (TP53) Target Info
P53_HUMAN
miRNA Mature ID hsa-miR-574-3p miRNA Info
miRNA Mature AC
MIMAT0003239
Sequence cacgcucaugcacacacccaca
miRNA Species Homo sapiens
Regulation Mechanism miR-574-3p ectopic expression significantly reduced the luciferase activity of the plasmid containing the 3'UTR of RXRa as compared to the control plasmid confirming the functional binding of miR-574-3p on its target (Fig. 2B). [3]
Evidence Score (E-score) 1 +
1 Luciferase Reporter Assay; Western Blot [3]
Representative Target(s) Regulated by This miRNA Epidermal growth factor receptor (EGFR) Target Info
EGFR_HUMAN
Histone acetyltransferase p300 (EP300) Target Info
EP300_HUMAN
References  Top
REF 1 MicroRNA-27a Contributes to Rhabdomyosarcoma Cell Proliferation by Suppressing RARA and RXRA. PLoS One. 2015 Apr 27;10(4):e0125171.
REF 2 MicroRNA-27a regulates lipid metabolism and inhibits hepatitis C virus replication in human hepatoma cells. J Virol. 2013 May;87(9):5270-86.
REF 3 Sox9-regulated miRNA-574-3p inhibits chondrogenic differentiation of mesenchymal stem cells. PLoS One. 2013 Apr 23;8(4):e62582.

If You Find Any Error in Data or Bug in Web Service, Please Kindly Report It to Dr. Zhou and Dr. Zhang.