Content Navigation
( All
None )
| Target General Information |
Top |
| Target ID |
T19011 |
Target Info
|
| Target Name |
M-phase inducer phosphatase 3 (MPIP3) |
| Synonyms |
Dual specificity phosphatase Cdc25C; Cdc25C phosphatase |
| Target Type |
Literature-reported Target |
| Gene Name |
CDC25C |
| Biochemical Class |
Phosphoric monoester hydrolase |
| UniProt ID |
|
| The microRNAs (miRNAs) Regulating This Target |
Top |
| miRNA Mature ID |
hsa-miR-142-3p |
miRNA Info
|
| miRNA Mature AC |
|
| Sequence |
uguaguguuuccuacuuuaugga
|
| miRNA Species |
Homo sapiens |
| Regulation Mechanism |
CDC25C is a direct target of miR-142-3p. |
[2] |
| Evidence Score (E-score) |
2 |
+ |
| 1 |
Luciferase Reporter Assay; Western Blot |
[1] |
| 2 |
qRT-PCR |
[2] |
| Representative Target(s) Regulated by This miRNA |
ATP-binding cassette transporter G2 (ABCG2)
|
Target Info
|
|
|
High mobility group protein B1 (HMGB1)
|
Target Info
|
|
| miRNA Mature ID |
hsa-miR-141-3p |
miRNA Info
|
| miRNA Mature AC |
|
| Sequence |
uaacacugucugguaaagaugg
|
| miRNA Species |
Homo sapiens |
| Evidence Score (E-score) |
1 |
+ |
| 1 |
Luciferase Reporter Assay; Western Blot |
[3] |
| Representative Target(s) Regulated by This miRNA |
Activin receptor type IIB (ACVR2B)
|
Target Info
|
|
|
Bromodomain-containing protein 3 (BRD3)
|
Target Info
|
|
| References |
Top |
| REF 1 |
miR-142-3p suppresses uveal melanoma by targeting CDC25C, TGFbetaR1, GNAQ, WASL, and RAC1. Cancer Manag Res. 2019 May 24;11:4729-4742.
|
| REF 2 |
miR-142-3p inhibits cancer cell proliferation by targeting CDC25C. Cell Prolif. 2016 Feb;49(1):58-68.
|
| REF 3 |
MicroRNA-141 is downregulated in human renal cell carcinoma and regulates cell survival by targeting CDC25B. Onco Targets Ther. 2013 Apr 10;6:349-54.
|
If You Find Any Error in Data or Bug in Web Service, Please Kindly Report It to Dr. Zhou and Dr. Zhang.
