Target Regulator(s) Information (MicroRNA)

Content Navigation (  All   None )                                      
Target General Information
The microRNAs (miRNAs) Regulating This Target
References
Target General Information  Top
Target ID T19244 Target Info
Target Name S-mephenytoin 4-hydroxylase (CYP2C9)
Synonyms Cytochrome P450 PB-1; Cytochrome P450 MP-8; Cytochrome P450 MP-4; Cytochrome P450 2C9; Cytochrome P-450MP; Cholesterol 25-hydroxylase; CYPIIC9; CYP2C10; (S)-limonene 7-monooxygenase; (S)-limonene 6-monooxygenase; (R)-limonene 6-monooxygenase
Target Type Successful Target
Gene Name CYP2C9
Biochemical Class Paired donor oxygen oxidoreductase
UniProt ID
P11712
The microRNAs (miRNAs) Regulating This Target  Top
miRNA Mature ID hsa-miR-130b-3p miRNA Info
miRNA Mature AC
MIMAT0000691
Sequence cagugcaaugaugaaagggcau
miRNA Species Homo sapiens
Regulation Mechanism CYP2C9 is directly regulated by miR-130b. [2]
Evidence Score (E-score) 2 +
1 Literature Reported [1]
2 Luciferase Reporter Assay; Western Blot [2]
Representative Target(s) Regulated by This miRNA Acyl-CoA desaturase (SCD) Target Info
ACOD_HUMAN
Cyclin A2 (CCNA2) Target Info
CCNA2_HUMAN
miRNA Mature ID hsa-miR-143-3p miRNA Info
miRNA Mature AC
MIMAT0000435
Sequence ugagaugaagcacuguagcuc
miRNA Species Homo sapiens
Regulation Mechanism hsa-miR-143-3p suppress CYP2C9 3'UTR luciferase reporter. [3]
Evidence Score (E-score) 1 +
1 EMSA; Luciferase Reporter Assay; Western Blot [3]
Representative Target(s) Regulated by This miRNA Apoptosis regulator Bcl-2 (BCL-2) Target Info
BCL2_HUMAN
Connective tissue growth factor (CTGF) Target Info
CTGF_HUMAN
References  Top
REF 1 Association of the Single Nucleotide Polymorphisms in microRNAs 130b, 200b, and 495 with Ischemic Stroke Susceptibility and Post-Stroke Mortality. PLoS One. 2016 Sep 7;11(9):e0162519.
REF 2 Inflammation-associated microRNA-130b down-regulates cytochrome P450 activities and directly targets CYP2C9. Drug Metab Dispos. 2015 Jun;43(6):884-8.
REF 3 Suppression of CYP2C9 by microRNA hsa-miR-128-3p in human liver cells and association with hepatocellular carcinoma. Sci Rep. 2015 Feb 23;5:8534.

If You Find Any Error in Data or Bug in Web Service, Please Kindly Report It to Dr. Zhou and Dr. Zhang.