Target Regulator(s) Information (MicroRNA)

Content Navigation (  All   None )                                      
Target General Information
The microRNAs (miRNAs) Regulating This Target
References
Target General Information  Top
Target ID T20585 Target Info
Target Name Signal transducer and activator of transcription 6 (STAT6)
Synonyms IL-4 Stat
Target Type Literature-reported Target
Gene Name STAT6
Biochemical Class Transcription factor
UniProt ID
P42226
The microRNAs (miRNAs) Regulating This Target  Top
miRNA Mature ID hsa-miR-135b-5p miRNA Info
miRNA Mature AC
MIMAT0000758
Sequence uauggcuuuucauuccuauguga
miRNA Species Homo sapiens
Regulation Mechanism miR-135b is a potential target STAT6 in PCa cells. [1]
Evidence Score (E-score) 1 +
1 Luciferase Reporter Assay [1]
Representative Target(s) Regulated by This miRNA Activin receptor type IB (ACVR1B) Target Info
ACV1B_HUMAN
Bone morphogenetic protein receptor (BMPR2) Target Info
BMPR2_HUMAN
miRNA Mature ID hsa-miR-1207-5p miRNA Info
miRNA Mature AC
MIMAT0005871
Sequence uggcagggaggcugggagggg
miRNA Species Homo sapiens
Regulation Mechanism miR-1207-5p promotes the proliferation of breast cancer cells by targeting STAT6. [2]
Evidence Score (E-score) 1 +
1 Luciferase Reporter Assay; Western Blot [2]
Representative Target(s) Regulated by This miRNA Macrophage colony-stimulating factor 1 (CSF1) Target Info
CSF1_HUMAN
Signal transducer and activator of transcription 6 (STAT6) Target Info
STAT6_HUMAN
miRNA Mature ID hsa-miR-135b-3p miRNA Info
miRNA Mature AC
MIMAT0004698
Sequence auguagggcuaaaagccauggg
miRNA Species Homo sapiens
Regulation Mechanism Transfection with miR-135b alone reduces STAT6 mRNA levels significantly. [3]
Evidence Score (E-score) 1 +
1 qRT-PCR; Western Blot [3]
Representative Target(s) Regulated by This miRNA Large tumor suppressor homolog 2 (LATS2) Target Info
LATS2_HUMAN
Signal transducer and activator of transcription 6 (STAT6) Target Info
STAT6_HUMAN
miRNA Mature ID hsa-miR-361-5p miRNA Info
miRNA Mature AC
MIMAT0000703
Sequence uuaucagaaucuccagggguac
miRNA Species Homo sapiens
Regulation Mechanism STAT6 is a direct target of miR-361-5p and promotes Bcl-xL. [4]
Evidence Score (E-score) 1 +
1 Luciferase Reporter Assay; Western Blot [4]
Representative Target(s) Regulated by This miRNA C-X-C chemokine receptor type 6 (CXCR6) Target Info
CXCR6_HUMAN
Signal transducer and activator of transcription 6 (STAT6) Target Info
STAT6_HUMAN
References  Top
REF 1 miR-135b inhibits tumour metastasis in prostate cancer by targeting STAT6. Oncol Lett. 2016 Jan;11(1):543-550.
REF 2 PVT1-derived miR-1207-5p promotes breast cancer cell growth by targeting STAT6. Cancer Sci. 2017 May;108(5):868-876.
REF 3 IL-13 mediates collagen deposition via STAT6 and microRNA-135b: a role for epigenetics. Sci Rep. 2016 Apr 26;6:25066.
REF 4 MiR-361-5p acts as a tumor suppressor in prostate cancer by targeting signal transducer and activator of transcription-6(STAT6). Biochem Biophys Res Commun. 2014 Feb 28;445(1):151-6.

If You Find Any Error in Data or Bug in Web Service, Please Kindly Report It to Dr. Zhou and Dr. Zhang.