Target Regulator(s) Information (MicroRNA)

Content Navigation (  All   None )                                      
Target General Information
The microRNAs (miRNAs) Regulating This Target
References
Target General Information  Top
Target ID T25309 Target Info
Target Name Signal transduction protein CBL (CBL)
Synonyms RNF55; RING-type E3 ubiquitin transferase CBL; RING finger protein 55; Proto-oncogene c-CBL; E3 ubiquitin-protein ligase CBL; Casitas B-lineage lymphoma proto-oncogene; CBL2; C-Cbl
Target Type Literature-reported Target
Gene Name CBL
Biochemical Class Acyltransferase
UniProt ID
P22681
The microRNAs (miRNAs) Regulating This Target  Top
miRNA Mature ID hsa-miR-150-5p miRNA Info
miRNA Mature AC
MIMAT0000451
Sequence ucucccaacccuuguaccagug
miRNA Species Homo sapiens
Evidence Score (E-score) 1 +
1 Luciferase Reporter Assay [1]
Representative Target(s) Regulated by This miRNA Apoptosis inhibitor survivin (BIRC5) Target Info
BIRC5_HUMAN
Beta-arrestin-2 (ARRB2) Target Info
ARRB2_HUMAN
miRNA Mature ID hsa-miR-216a-5p miRNA Info
miRNA Mature AC
MIMAT0000273
Sequence uaaucucagcuggcaacuguga
miRNA Species Homo sapiens
Evidence Score (E-score) 1 +
1 Luciferase Reporter Assay; Western Blot [2]
Representative Target(s) Regulated by This miRNA Beclin-1 (BECN1) Target Info
BECN1_HUMAN
Extracellular matrix receptor III (CD44) Target Info
CD44_HUMAN
miRNA Mature ID hsa-miR-98-5p miRNA Info
miRNA Mature AC
MIMAT0000096
Sequence ugagguaguaaguuguauuguu
miRNA Species Homo sapiens
Regulation Mechanism Transfection with miR-98 suppressed CBL expression. [3]
Evidence Score (E-score) 1 +
1 Western Blot [3]
Representative Target(s) Regulated by This miRNA Apoptosis regulator Bcl-2 (BCL-2) Target Info
BCL2_HUMAN
Aromatase (CYP19A1) Target Info
CP19A_HUMAN
miRNA Mature ID hsa-miR-188-3p miRNA Info
miRNA Mature AC
MIMAT0004613
Sequence cucccacaugcaggguuugca
miRNA Species Homo sapiens
Regulation Mechanism Transfection with miR-188-3p suppressed CBL expression. [3]
Evidence Score (E-score) 1 +
1 Western Blot [3]
Representative Target(s) Regulated by This miRNA Signal transduction protein CBL (CBL) Target Info
CBL_HUMAN
References  Top
REF 1 miR-150 blocks MLL-AF9-associated leukemia through oncogene repression. Mol Cancer Res. 2013 Aug;11(8):912-22.
REF 2 miR-216a rescues dexamethasone suppression of osteogenesis, promotes osteoblast differentiation and enhances bone formation, by regulating c-Cbl-mediated PI3K/AKT pathway. Cell Death Differ. 2015 Dec;22(12):1935-45.
REF 3 Overexpression of X-linked genes in T cells from women with lupus. J Autoimmun. 2013 Mar;41:60-71.

If You Find Any Error in Data or Bug in Web Service, Please Kindly Report It to Dr. Zhou and Dr. Zhang.