The microRNAs (miRNAs) Regulating This Target |
Top |
miRNA Mature ID |
hsa-let-7e-5p |
miRNA Info
|
miRNA Mature AC |
|
Sequence |
ugagguaggagguuguauaguu
|
miRNA Species |
Homo sapiens |
Regulation Mechanism |
Ectopic expression of let-7e reduces proliferation and downregulates AURKB. |
[1] |
Evidence Score (E-score) |
2 |
+ |
1 |
Luciferase Reporter Assay; Western Blot |
[1] |
2 |
Western Blot |
[1] |
Representative Target(s) Regulated by This miRNA |
Apoptosis antigen ligand (CD178)
|
Target Info
|
|
Aurora kinase B (AURKB)
|
Target Info
|
|
miRNA Mature ID |
hsa-miR-24-3p |
miRNA Info
|
miRNA Mature AC |
|
Sequence |
uggcucaguucagcaggaacag
|
miRNA Species |
Homo sapiens |
Evidence Score (E-score) |
2 |
+ |
1 |
Luciferase Reporter Assay |
[2] |
2 |
RT-PCR |
[3] |
Representative Target(s) Regulated by This miRNA |
Activin receptor type IB (ACVR1B)
|
Target Info
|
|
Aurora kinase B (AURKB)
|
Target Info
|
|
miRNA Mature ID |
hsa-let-7i-5p |
miRNA Info
|
miRNA Mature AC |
|
Sequence |
ugagguaguaguuugugcuguu
|
miRNA Species |
Homo sapiens |
Regulation Mechanism |
Let-7i inhibits the malignant phenotype of osteosarcoma cells by targeting AURKB indicating that AURKB is a likely to be a direct target negatively regulated by let-7i. |
[4] |
Evidence Score (E-score) |
1 |
+ |
1 |
Luciferase Reporter Assay; Western Blot |
[4] |
Representative Target(s) Regulated by This miRNA |
Aurora kinase B (AURKB)
|
Target Info
|
|
Bone morphogenetic protein 4 (BMP4)
|
Target Info
|
|
miRNA Mature ID |
hsa-miR-204-5p |
miRNA Info
|
miRNA Mature AC |
|
Sequence |
uucccuuugucauccuaugccu
|
miRNA Species |
Homo sapiens |
Regulation Mechanism |
The overexpression of miR-204-5p by mature miRNA transfection resulted in the changed mRNA level of target AURKB. |
[2] |
Evidence Score (E-score) |
1 |
+ |
1 |
qRT-PCR |
[2] |
Representative Target(s) Regulated by This miRNA |
Alkaline phosphatase tissue-nonspecific (ALPL)
|
Target Info
|
|
Apoptosis regulator Bcl-2 (BCL-2)
|
Target Info
|
|