Content Navigation
( All
None )
Target General Information |
Top |
Target ID |
T60254 |
Target Info
|
Target Name |
Voltage-gated potassium channel Kv10.1 (KCNH1) |
Synonyms |
hEAG1; h-eag; Voltage-gated potassium channel subunit Kv10.1; Potassium voltage-gated channel subfamily H member 1; EAG1; EAG channel 1; EAG |
Target Type |
Literature-reported Target |
Gene Name |
KCNH1 |
Biochemical Class |
Voltage-gated ion channel |
UniProt ID |
|
The microRNAs (miRNAs) Regulating This Target |
Top |
miRNA Mature ID |
hsa-miR-34a-5p |
miRNA Info
|
miRNA Mature AC |
|
Sequence |
uggcagugucuuagcugguugu
|
miRNA Species |
Homo sapiens |
Regulation Mechanism |
Endogenous Eag1 protein level in miR-34a group cells was significantly decreased. |
[1] |
Evidence Score (E-score) |
1 |
+ |
1 |
Western Blot |
[1] |
Representative Target(s) Regulated by This miRNA |
Amphiregulin (AREG)
|
Target Info
|
|
Androgen receptor (AR)
|
Target Info
|
|
miRNA Mature ID |
hsa-miR-296-3p |
miRNA Info
|
miRNA Mature AC |
|
Sequence |
gaggguuggguggaggcucucc
|
miRNA Species |
Homo sapiens |
Regulation Mechanism |
EAG1 as a direct target of miR-296-3p in GBM cells. |
[2] |
Evidence Score (E-score) |
1 |
+ |
1 |
Luciferase Reporter Assay; Western Blot |
[2] |
Representative Target(s) Regulated by This miRNA |
C-X3-C chemokine receptor 1 (CX3CR1)
|
Target Info
|
|
Intercellular adhesion molecule ICAM-1 (ICAM1)
|
Target Info
|
|
References |
Top |
REF 1 |
MicroRNA-34a inhibits human osteosarcoma proliferation by downregulating ether go-go 1 expression. Int J Med Sci. 2013;10(6):676-82.
|
REF 2 |
MiR-296-3p regulates cell growth and multi-drug resistance of human glioblastoma by targeting ether- go-go (EAG1). Eur J Cancer. 2013 Feb;49(3):710-24.
|
If You Find Any Error in Data or Bug in Web Service, Please Kindly Report It to Dr. Zhou and Dr. Zhang.