Target Regulator(s) Information (MicroRNA)
| Target General Information | Top | ||||
|---|---|---|---|---|---|
| Target ID | T61698 | Target Info | |||
| Target Name | Interleukin-2 (IL2) | ||||
| Synonyms | TCGF; T-cell growth factor; IL-2; Aldesleukin | ||||
| Target Type | Successful Target | ||||
| Gene Name | IL2 | ||||
| Biochemical Class | Cytokine: interleukin | ||||
| UniProt ID | |||||
| The microRNAs (miRNAs) Regulating This Target | Top | ||||
|---|---|---|---|---|---|
| miRNA Mature ID | hsa-let-7i-5p | miRNA Info | |||
| miRNA Mature AC | |||||
| Sequence | ugagguaguaguuugugcuguu | ||||
| miRNA Species | Homo sapiens | ||||
| Evidence Score (E-score) | 2 | + | |||
| 1 | Luciferase Reporter Assay | [1] | |||
| 2 | PAR-CLIP | [2] | |||
| Representative Target(s) Regulated by This miRNA | Aurora kinase B (AURKB) | Target Info | |||
| Bone morphogenetic protein 4 (BMP4) | Target Info | ||||
| miRNA Mature ID | hsa-miR-155-5p | miRNA Info | |||
| miRNA Mature AC | |||||
| Sequence | uuaaugcuaaucgugauagggguu | ||||
| miRNA Species | Homo sapiens | ||||
| Regulation Mechanism | miR-155 overexpression decreases IL-2 mRNA. | [3] | |||
| Evidence Score (E-score) | 2 | + | |||
| 1 | qRT-PCR | [3] | |||
| 2 | Reporter Assay | [4] | |||
| Representative Target(s) Regulated by This miRNA | Acetyl-CoA transporter (SLC33A1) | Target Info | |||
| Angiotensin II receptor type-1 (AGTR1) | Target Info | ||||
| miRNA Mature ID | hsa-miR-181c-5p | miRNA Info | |||
| miRNA Mature AC | |||||
| Sequence | aacauucaaccugucggugagu | ||||
| miRNA Species | Homo sapiens | ||||
| Evidence Score (E-score) | 1 | + | |||
| 1 | Reporter Assay | [5] | |||
| Representative Target(s) Regulated by This miRNA | Apoptosis regulator Bcl-2 (BCL-2) | Target Info | |||
| Bone morphogenetic protein receptor (BMPR2) | Target Info | ||||
| miRNA Mature ID | hsa-miR-503-3p | miRNA Info | |||
| miRNA Mature AC | |||||
| Sequence | gggguauuguuuccgcugccagg | ||||
| miRNA Species | Homo sapiens | ||||
| Regulation Mechanism | Inhibition of miR-503 expression down regulated IL2 expression and facilitate secretion of IL4 and IL10. | [6] | |||
| Evidence Score (E-score) | 1 | + | |||
| 1 | ELISA | [6] | |||
| Representative Target(s) Regulated by This miRNA | Interleukin-10 (IL10) | Target Info | |||
| Interleukin-2 (IL2) | Target Info | ||||
| References | Top | ||||
|---|---|---|---|---|---|
| REF 1 | HIV-1 Infection-Induced Suppression of the Let-7i/IL-2 Axis Contributes to CD4(+) T Cell Death. Sci Rep. 2016 May 5;6:25341. | ||||
| REF 2 | MicroRNA target site identification by integrating sequence and binding information. Nat Methods. 2013 Jul;10(7):630-3. | ||||
| REF 3 | TGF- conditions intestinal T cells to express increased levels of miR-155, associated with down-regulation of IL-2 and itk mRNA. Mucosal Immunol. 2013 Jan;6(1):167-76. | ||||
| REF 4 | MicroRNA-155 Protects Group 2 Innate Lymphoid Cells From Apoptosis to Promote Type-2 Immunity. Front Immunol. 2018 Oct 9;9:2232. | ||||
| REF 5 | Human activated CD4(+) T lymphocytes increase IL-2 expression by downregulating microRNA-181c. Mol Immunol. 2011 Jan;48(4):592-9. | ||||
| REF 6 | Effect of miR-503 Down-Regulation on Growth and Invasion of Esophagus Carcinoma and Related Immune Function. Med Sci Monit. 2015 Nov 18;21:3564-9. | ||||
If You Find Any Error in Data or Bug in Web Service, Please Kindly Report It to Dr. Zhou and Dr. Zhang.