Target Regulator(s) Information (MicroRNA)
| Target General Information | Top | ||||
|---|---|---|---|---|---|
| Target ID | T64245 | Target Info | |||
| Target Name | Apoptosis antigen ligand (CD178) | ||||
| Synonyms | Tumor necrosis factor ligand superfamily member 6; TNFSF6; FasL; Fas ligand; FAS antigen ligand; CD95L; CD95-L; CD95 ligand; CD178 antigen; CD178; APTL; APT1LG1 | ||||
| Target Type | Literature-reported Target | ||||
| Gene Name | FASLG | ||||
| Biochemical Class | Cytokine: tumor necrosis factor | ||||
| UniProt ID | |||||
| The microRNAs (miRNAs) Regulating This Target | Top | ||||
|---|---|---|---|---|---|
| miRNA Mature ID | hsa-miR-21-5p | miRNA Info | |||
| miRNA Mature AC | |||||
| Sequence | uagcuuaucagacugauguuga | ||||
| miRNA Species | Homo sapiens | ||||
| Evidence Score (E-score) | 6 | + | |||
| 1 | Luciferase Reporter Assay | [1] | |||
| 2 | Luciferase Reporter Assay; qRT-PCR; Western Blot | [2] | |||
| 3 | Luciferase Reporter Assay; qRT-PCR; Western Blot | [3] | |||
| 4 | Luciferase Reporter Assay; Western Blot | [4] | |||
| 5 | Luciferase Reporter Assay; Western Blot | [5] | |||
| 6 | Reporter Assay; Western Blot | [6] | |||
| Representative Target(s) Regulated by This miRNA | Apoptosis antigen ligand (CD178) | Target Info | |||
| Apoptosis regulator Bcl-2 (BCL-2) | Target Info | ||||
| miRNA Mature ID | hsa-miR-21-3p | miRNA Info | |||
| miRNA Mature AC | |||||
| Sequence | caacaccagucgaugggcugu | ||||
| miRNA Species | Homo sapiens | ||||
| Regulation Mechanism | FASLG was the direct target of miR-21. | [7] | |||
| Evidence Score (E-score) | 2 | + | |||
| 1 | Luciferase Reporter Assay; Western Blot | [7] | |||
| 2 | Western Blot | [7] | |||
| Representative Target(s) Regulated by This miRNA | Apoptosis antigen ligand (CD178) | Target Info | |||
| Phosphatase and tensin homolog (PTEN) | Target Info | ||||
| miRNA Mature ID | hsa-let-7e-5p | miRNA Info | |||
| miRNA Mature AC | |||||
| Sequence | ugagguaggagguuguauaguu | ||||
| miRNA Species | Homo sapiens | ||||
| Regulation Mechanism | FASLG is a target of let-7e-5p. | [8] | |||
| Evidence Score (E-score) | 1 | + | |||
| 1 | Luciferase Reporter Assay | [8] | |||
| Representative Target(s) Regulated by This miRNA | Apoptosis antigen ligand (CD178) | Target Info | |||
| Aurora kinase B (AURKB) | Target Info | ||||
| miRNA Mature ID | hsa-miR-149-5p | miRNA Info | |||
| miRNA Mature AC | |||||
| Sequence | ucuggcuccgugucuucacuccc | ||||
| miRNA Species | Homo sapiens | ||||
| Regulation Mechanism | Overexpression of miR-149-5p resulted in decreased both mRNA and protein level of FASLG. | [9] | |||
| Evidence Score (E-score) | 1 | + | |||
| 1 | Luciferase Reporter Assay; Western Blot | [9] | |||
| Representative Target(s) Regulated by This miRNA | Apoptosis antigen ligand (CD178) | Target Info | |||
| Bcl-2-binding component 3 (BBC3) | Target Info | ||||
| References | Top | ||||
|---|---|---|---|---|---|
| REF 1 | Regulation of the extrinsic apoptotic pathway by microRNA-21 in alcoholic liver injury. J Biol Chem. 2014 Oct 3;289(40):27526-39. | ||||
| REF 2 | miR-21 regulates N-methyl-N-nitro-N'-nitrosoguanidine-induced gastric tumorigenesis by targeting FASLG and BTG2. Toxicol Lett. 2014 Aug 4;228(3):147-56. | ||||
| REF 3 | The serum miR-21 level serves as a predictor for the chemosensitivity of advanced pancreatic cancer, and miR-21 expression confers chemoresistance by targeting FasL. Mol Oncol. 2013 Jun;7(3):334-45. | ||||
| REF 4 | MiR-21 down-regulation suppresses cell growth, invasion and induces cell apoptosis by targeting FASL, TIMP3, and RECK genes in esophageal carcinoma. Dig Dis Sci. 2013 Jul;58(7):1863-70. | ||||
| REF 5 | miR-21 modulates cell apoptosis by targeting multiple genes in renal cell carcinoma. Urology. 2011 Aug;78(2):474.e13-9. | ||||
| REF 6 | Foxo3a regulates apoptosis by negatively targeting miR-21. J Biol Chem. 2010 May 28;285(22):16958-66. | ||||
| REF 7 | MiR-21 up-regulation mediates glioblastoma cancer stem cells apoptosis and proliferation by targeting FASLG. Mol Biol Rep. 2015 Mar;42(3):721-7. | ||||
| REF 8 | Downregulation of let-7e-5p contributes to endothelial progenitor cell dysfunction in deep vein thrombosis via targeting FASLG. Thromb Res. 2016 Feb;138:30-36. | ||||
| REF 9 | Inhibition of MicroRNA-149-5p Induces Apoptosis of Acute Myeloid Leukemia Cell Line THP-1 by Targeting Fas Ligand (FASLG). Med Sci Monit. 2016 Dec 25;22:5116-5123. | ||||
If You Find Any Error in Data or Bug in Web Service, Please Kindly Report It to Dr. Zhou and Dr. Zhang.