Target Regulator(s) Information (MicroRNA)

Content Navigation (  All   None )                                      
Target General Information
The microRNAs (miRNAs) Regulating This Target
References
Target General Information  Top
Target ID T65889 Target Info
Target Name Pyruvate kinase M2 (PKM)
Synonyms p58; Tumor M2-PK; Thyroid hormone-binding protein 1; THBP1; Pyruvate kinase muscle isozyme; Pyruvate kinase isozymes M1/M2; Pyruvate kinase PKM; Pyruvate kinase 2/3; PKM2; PK3; PK2; Opa-interacting protein 3; OIP3; OIP-3; Cytosolic thyroid hormone-binding protein; CTHBP
Target Type Clinical trial Target
Gene Name PKM
Biochemical Class Kinase
UniProt ID
P14618
The microRNAs (miRNAs) Regulating This Target  Top
miRNA Mature ID hsa-miR-133b miRNA Info
miRNA Mature AC
MIMAT0000770
Sequence uuugguccccuucaaccagcua
miRNA Species Homo sapiens
Regulation Mechanism Aberrant reduction of miR-133b was associated with the dysregulation of PKM2 in SCC of tongue. [1]
Evidence Score (E-score) 3 +
1 Immunohistochemistry [1]
2 qRT-PCR; Western Blot [2]
3 Western Blot [3]
Representative Target(s) Regulated by This miRNA Apoptosis mediating surface antigen FAS (FAS) Target Info
TNR6_HUMAN
Apoptosis regulator Bcl-W (BCL-W) Target Info
B2CL2_HUMAN
miRNA Mature ID hsa-miR-122-5p miRNA Info
miRNA Mature AC
MIMAT0000421
Sequence uggagugugacaaugguguuug
miRNA Species Homo sapiens
Evidence Score (E-score) 2 +
1 HITS-CLIP [4]
2 Luciferase Reporter Assay; qRT-PCR; Western Blot [5]
Representative Target(s) Regulated by This miRNA Apoptosis regulator Bcl-W (BCL-W) Target Info
B2CL2_HUMAN
Apoptosis regulator Bcl-xL (BCL-xL) Target Info
B2CL1_HUMAN
miRNA Mature ID hsa-miR-184 miRNA Info
miRNA Mature AC
MIMAT0000454
Sequence uggacggagaacugauaagggu
miRNA Species Homo sapiens
Regulation Mechanism miR-184 specifically represses PKM2 expression. In brief, our data indicated PKM2 is a new target of miR-184 in ccRCC cells. [6]
Evidence Score (E-score) 1 +
1 Luciferase Reporter Assay; Western Blot [6]
Representative Target(s) Regulated by This miRNA Apoptosis regulator Bcl-2 (BCL-2) Target Info
BCL2_HUMAN
Platelet-derived growth factor B (PDGFB) Target Info
PDGFB_HUMAN
miRNA Mature ID hsa-miR-326 miRNA Info
miRNA Mature AC
MIMAT0000756
Sequence ccucugggcccuuccuccag
miRNA Species Homo sapiens
Regulation Mechanism PKM2 is a direct and functional target of miR-326 suggesting that miR-326 could regulate the glioma metabolism through its regulation. [7]
Evidence Score (E-score) 1 +
1 Luciferase Reporter Assay; Western Blot [7]
Representative Target(s) Regulated by This miRNA Apoptosis regulator Bcl-xL (BCL-xL) Target Info
B2CL1_HUMAN
Fascin (FSCN1) Target Info
FSCN1_HUMAN
miRNA Mature ID hsa-miR-338-3p miRNA Info
miRNA Mature AC
MIMAT0000763
Sequence uccagcaucagugauuuuguug
miRNA Species Homo sapiens
Regulation Mechanism PKM2 was verified as a target gene of miR-338-3p by luciferase assay. [8]
Evidence Score (E-score) 1 +
1 Luciferase Reporter Assay; Western Blot [8]
Representative Target(s) Regulated by This miRNA G1/S-specific cyclin-D1 (CCND1) Target Info
CCND1_HUMAN
Hypoxia-inducible factor 1 alpha (HIF-1A) Target Info
HIF1A_HUMAN
miRNA Mature ID hsa-miR-369-3p miRNA Info
miRNA Mature AC
MIMAT0000721
Sequence aauaauacaugguugaucuuu
miRNA Species Homo sapiens
Regulation Mechanism Overexpression of miR-369 stimulated Pkm2 splicing and enhanced induction of cellular reprogramming by induced pluripotent stem cell factors, whereas miR-369 knockdown resulted in suppression. [9]
Evidence Score (E-score) 1 +
1 Luciferase Reporter Assay; Western Blot [9]
Representative Target(s) Regulated by This miRNA Pyruvate kinase M2 (PKM) Target Info
KPYM_HUMAN
References  Top
REF 1 Identification of pyruvate kinase type M2 as potential oncoprotein in squamous cell carcinoma of tongue through microRNA profiling. Int J Cancer. 2008 Jul 15;123(2):251-257.
REF 2 [MiR-133b Affect the Proliferation and Drug Sensitivity in A549 Lung Cancer Stem Cells by Targeting PKM2]. Zhongguo Fei Ai Za Zhi. 2017 Jun 20;20(6):376-381.
REF 3 Overexpression of microRNA-133b sensitizes non-small cell lung cancer cells to irradiation through the inhibition of glycolysis. Oncol Lett. 2016 Apr;11(4):2903-2908.
REF 4 Insights into snoRNA biogenesis and processing from PAR-CLIP of snoRNA core proteins and small RNA sequencing. Genome Biol. 2013 May 26;14(5):R45.
REF 5 miR-122 targets pyruvate kinase M2 and affects metabolism of hepatocellular carcinoma. PLoS One. 2014 Jan 23;9(1):e86872.
REF 6 c-Myc modulates glucose metabolism via regulation of miR-184/PKM2 pathway in clear-cell renal cell carcinoma. Int J Oncol. 2016 Oct;49(4):1569-75.
REF 7 Pyruvate kinase M2 is a target of the tumor-suppressive microRNA-326 and regulates the survival of glioma cells. Neuro Oncol. 2010 Nov;12(11):1102-12.
REF 8 MiR-338-3p targets pyruvate kinase M2 and affects cell proliferation and metabolism of ovarian cancer. Am J Transl Res. 2016 Jul 15;8(7):3266-73.
REF 9 Embryonic MicroRNA-369 Controls Metabolic Splicing Factors and Urges Cellular Reprograming. PLoS One. 2015 Jul 15;10(7):e0132789.

If You Find Any Error in Data or Bug in Web Service, Please Kindly Report It to Dr. Zhou and Dr. Zhang.