The microRNAs (miRNAs) Regulating This Target |
Top |
miRNA Mature ID |
hsa-miR-25-3p |
miRNA Info
|
miRNA Mature AC |
|
Sequence |
cauugcacuugucucggucuga
|
miRNA Species |
Homo sapiens |
Regulation Mechanism |
The decrease in PRMT5 protein expression was mediated by miR-25. |
[2] |
Evidence Score (E-score) |
2 |
+ |
1 |
qRT-PCR |
[1] |
2 |
Western Blot |
[2] |
Representative Target(s) Regulated by This miRNA |
CDK inhibitor 1C p57Kip2 (CDKN1C)
|
Target Info
|
|
Cellular tumor antigen p53 (TP53)
|
Target Info
|
|
miRNA Mature ID |
hsa-miR-92b-3p |
miRNA Info
|
miRNA Mature AC |
|
Sequence |
uauugcacucgucccggccucc
|
miRNA Species |
Homo sapiens |
Regulation Mechanism |
The decrease in PRMT5 protein expression was mediated by miR-92b. |
[2] |
Evidence Score (E-score) |
2 |
+ |
1 |
Western Blot |
[2] |
2 |
Western Blot |
[3] |
Representative Target(s) Regulated by This miRNA |
CDK inhibitor 1C p57Kip2 (CDKN1C)
|
Target Info
|
|
Dickkopf-related protein 3 (DKK3)
|
Target Info
|
|
miRNA Mature ID |
hsa-miR-19a-3p |
miRNA Info
|
miRNA Mature AC |
|
Sequence |
ugugcaaaucuaugcaaaacuga
|
miRNA Species |
Homo sapiens |
Regulation Mechanism |
The decrease in PRMT5 protein expression was mediated by miR-19a. |
[2] |
Evidence Score (E-score) |
1 |
+ |
1 |
Western Blot |
[2] |
Representative Target(s) Regulated by This miRNA |
Adrenergic receptor beta-1 (ADRB1)
|
Target Info
|
|
Apoptosis signal-regulating kinase 1 (MAP3K5)
|
Target Info
|
|
miRNA Mature ID |
hsa-miR-32-5p |
miRNA Info
|
miRNA Mature AC |
|
Sequence |
uauugcacauuacuaaguugca
|
miRNA Species |
Homo sapiens |
Regulation Mechanism |
The decrease in PRMT5 protein expression was mediated by miR-32. |
[2] |
Evidence Score (E-score) |
1 |
+ |
1 |
Western Blot |
[2] |
Representative Target(s) Regulated by This miRNA |
Aurora kinase A (AURKA)
|
Target Info
|
|
F-box and WD-40 domain protein 7 (Fbxw7)
|
Target Info
|
|
miRNA Mature ID |
hsa-miR-96-5p |
miRNA Info
|
miRNA Mature AC |
|
Sequence |
uuuggcacuagcacauuuuugcu
|
miRNA Species |
Homo sapiens |
Regulation Mechanism |
The decrease in PRMT5 protein expression was mediated by miR-96. |
[2] |
Evidence Score (E-score) |
1 |
+ |
1 |
Western Blot |
[2] |
Representative Target(s) Regulated by This miRNA |
5-HT 1B receptor (HTR1B)
|
Target Info
|
|
ALK tyrosine kinase receptor (ALK)
|
Target Info
|
|