Target Regulator(s) Information (MicroRNA)

Content Navigation (  All   None )                                      
Target General Information
The microRNAs (miRNAs) Regulating This Target
References
Target General Information  Top
Target ID T91130 Target Info
Target Name LDL receptor related protein-1 (LRP-1)
Synonyms Alpha-2-macroglobulin receptor; A2MR
Target Type Literature-reported Target
Gene Name LRP1
Biochemical Class Low density lipoprotein receptor
UniProt ID
Q07954
The microRNAs (miRNAs) Regulating This Target  Top
miRNA Mature ID hsa-miR-205-5p miRNA Info
miRNA Mature AC
MIMAT0000266
Sequence uccuucauuccaccggagucug
miRNA Species Homo sapiens
Regulation Mechanism The endogenous level of LRP1 was decreased compared to negative miRNA-205. [2]
Evidence Score (E-score) 2 +
1 Immunohistochemistry [1]
2 Luciferase Reporter Assay; Western Blot [2]
Representative Target(s) Regulated by This miRNA Androgen receptor (AR) Target Info
ANDR_HUMAN
Apoptosis regulator Bcl-2 (BCL-2) Target Info
BCL2_HUMAN
miRNA Mature ID hsa-miR-338-5p miRNA Info
miRNA Mature AC
MIMAT0004701
Sequence aacaauauccuggugcugagug
miRNA Species Homo sapiens
Evidence Score (E-score) 2 +
1 Immunohistochemistry [1]
2 Luciferase Reporter Assay; Western Blot [2]
Representative Target(s) Regulated by This miRNA LDL receptor related protein-1 (LRP-1) Target Info
LRP1_HUMAN
Lysophosphatidic acid receptor 1 (LPAR1) Target Info
LPAR1_HUMAN
miRNA Mature ID hsa-miR-545-3p miRNA Info
miRNA Mature AC
MIMAT0003165
Sequence ucagcaaacauuuauugugugc
miRNA Species Homo sapiens
Evidence Score (E-score) 1 +
1 Luciferase Reporter Assay; Western Blot [2]
Representative Target(s) Regulated by This miRNA Cyclin-dependent kinase 4 (CDK4) Target Info
CDK4_HUMAN
LDL receptor related protein-1 (LRP-1) Target Info
LRP1_HUMAN
References  Top
REF 1 LRP1 expression in colon cancer predicts clinical outcome. Oncotarget. 2018 Jan 13;9(10):8849-8869.
REF 2 MicroRNA-205 inhibits tumor cell migration through down-regulating the expression of the LDL receptor-related protein 1. Biochem Biophys Res Commun. 2009 Oct 16;388(2):400-5.

If You Find Any Error in Data or Bug in Web Service, Please Kindly Report It to Dr. Zhou and Dr. Zhang.