miRNA Details
| miRNA General Information | |||||
|---|---|---|---|---|---|
| miRNA Mature ID | hsa-miR-497-5p | ||||
| miRNA Stemloop AC | MI0003138 | ||||
| miRNA Stemloop ID | hsa-mir-497 | ||||
| Sequence | cagcagcacacugugguuugu | ||||
| TTD Target(s) Regulated by This miRNA | Serine/threonine-protein kinase mTOR (mTOR) | Successful Target | Target Info | [1] | |
| Cyclin-dependent kinase 4 (CDK4) | Successful Target | Target Info | [2] | ||
| Insulin-like growth factor I receptor (IGF1R) | Successful Target | Target Info | [3] | ||
| Apoptosis regulator Bcl-2 (BCL-2) | Successful Target | Target Info | [4] | ||
| Estrogen-related receptor-alpha (ESRRA) | Successful Target | Target Info | [5] | ||
| ERK activator kinase 1 (MEK1) | Clinical trial Target | Target Info | [6] | ||
| Checkpoint kinase-1 (CHK1) | Clinical trial Target | Target Info | [7] | ||
| Inhibitor of nuclear factor kappa-B kinase beta (IKKB) | Clinical trial Target | Target Info | [8] | ||
| Ribosomal protein S6 kinase beta-1 (S6K1) | Clinical trial Target | Target Info | [1] | ||
| Wee1-like protein kinase (WEE1) | Clinical trial Target | Target Info | [9] | ||
| Apoptosis inhibitor survivin (BIRC5) | Clinical trial Target | Target Info | [10] | ||
| Proto-oncogene c-RAF (c-RAF) | Clinical trial Target | Target Info | [11] | ||
| Calcium-activated potassium channel KCa3.1 (KCNN4) | Clinical trial Target | Target Info | [12] | ||
| Facilitates chromatin transcription complex (FACT) | Clinical trial Target | Target Info | [9] | ||
| M-phase inducer phosphatase 1 (MPIP1) | Literature-reported Target | Target Info | [2] | ||
| G1/S-specific cyclin-E1 (CCNE1) | Literature-reported Target | Target Info | [9] | ||
| Cyclin D (CCND3) | Literature-reported Target | Target Info | [2] | ||
| Eukaryotic initiation factor 4E (EIF4E) | Literature-reported Target | Target Info | [13] | ||
| Hepatoma-derived growth factor (HDGF) | Literature-reported Target | Target Info | [9] | ||
| Wnt-7a protein (WNT7A) | Literature-reported Target | Target Info | [10] | ||
| Angiomotin (AMOT) | Literature-reported Target | Target Info | [14] | ||
| Runt-related transcription factor 2 (RUNX2) | Literature-reported Target | Target Info | [11] | ||
| Suppressor of tumorigenicity 15 protein (ST15) | Literature-reported Target | Target Info | [15] | ||
| Mothers against decapentaplegic homolog 3 (SMAD3) | Preclinical Target | Target Info | [16] | ||
| Protein(s) Regulated by This miRNA | Anillin | Regulated Protein | [17] | ||
| E3 ubiquitin-protein ligase SMURF1 | Regulated Protein | [18] | |||
| F-box/WD repeat-containing protein 1A | Regulated Protein | [2] | |||
| Heat shock 70 kDa protein 4L | Regulated Protein | [17] | |||
| Metastasis-associated in colon cancer protein 1 | Regulated Protein | [20] | |||
| Pre-B-cell leukemia transcription factor 3 | Regulated Protein | [21] | |||
| Twist-related protein 1 | Regulated Protein | [22] | |||
| References | |||||
| REF 1 | MiR-497 decreases cisplatin resistance in ovarian cancer cells by targeting mTOR/P70S6K1. Oncotarget. 2015 Sep 22;6(28):26457-71. | ||||
| REF 2 | The tumor-suppressive miR-497-195 cluster targets multiple cell-cycle regulators in hepatocellular carcinoma. PLoS One. 2013;8(3):e60155. | ||||
| REF 3 | MicroRNA-497 targets insulin-like growth factor 1 receptor and has a tumour suppressive role in human colorectal cancer. Oncogene. 2013 Apr 11;32(15):1910-20. | ||||
| REF 4 | miR-497 modulates multidrug resistance of human cancer cell lines by targeting BCL2. Med Oncol. 2012 Mar;29(1):384-91. | ||||
| REF 5 | MicroRNA-497 downregulation contributes to cell proliferation, migration, and invasion of estrogen receptor alpha negative breast cancer by targeti... Tumour Biol. 2016 Oct;37(10):13205-13214. | ||||
| REF 6 | MicroRNA 497 modulates interleukin 1 signalling via the MAPK/ERK pathway. FEBS Lett. 2012 Nov 30;586(23):4165-72. | ||||
| REF 7 | Checkpoint kinase 1 is negatively regulated by miR-497 in hepatocellular carcinoma. Med Oncol. 2014 Mar;31(3):844. | ||||
| REF 8 | Tumor-suppressive microRNA-497 targets IKK to regulate NF-B signaling pathway in human prostate cancer cells. Am J Cancer Res. 2015 Apr 15;5(5):1795-804. | ||||
| REF 9 | Transcriptome-wide identification of RNA-binding protein and microRNA target sites by PAR-CLIP. Cell. 2010 Apr 2;141(1):129-41. | ||||
| REF 10 | The microRNA expression signature of bladder cancer by deep sequencing: the functional significance of the miR-195/497 cluster. PLoS One. 2014 Feb 10;9(2):e84311. | ||||
| REF 11 | Analysis of MiR-195 and MiR-497 expression, regulation and role in breast cancer. Clin Cancer Res. 2011 Apr 1;17(7):1722-30. | ||||
| REF 12 | miR-497-5p inhibits cell proliferation and invasion by targeting KCa3.1 in angiosarcoma. Oncotarget. 2016 Sep 6;7(36):58148-58161. | ||||
| REF 13 | The putative tumor suppressor microRNA-497 modulates gastric cancer cell proliferation and invasion by repressing eIF4E. Biochem Biophys Res Commun. 2014 Jun 27;449(2):235-40. | ||||
| REF 14 | A quantitative analysis of CLIP methods for identifying binding sites of RNA-binding proteins. Nat Methods. 2011 May 15;8(7):559-64. | ||||
| REF 15 | The role of miR-497-5p in myofibroblast differentiation of LR-MSCs and pulmonary fibrogenesis. Sci Rep. 2017 Jan 18;7:40958. | ||||
| REF 16 | Experimental evidences for hsa-miR-497-5p as a negative regulator of SMAD3 gene expression. Gene. 2016 Jul 25;586(2):216-21. | ||||
| REF 17 | The potent tumor suppressor miR-497 inhibits cancer phenotypes in nasopharyngeal carcinoma by targeting ANLN and HSPA4L.Oncotarget. 2015 Nov 3;6(34):35893-907. | ||||
| REF 18 | MicroRNA-497 inhibition of ovarian cancer cell migration and invasion through targeting of SMAD specific E3 ubiquitin protein ligase 1.Biochem Biophys Res Commun. 2014 Jul 11;449(4):432-7. | ||||
| REF 19 | The tumor-suppressive miR-497-195 cluster targets multiple cell-cycle regulators in hepatocellular carcinoma. PLoS One. 2013;8(3):e60155. | ||||
| REF 20 | Long non-coding RNA XIST promotes cell growth and invasion through regulating miR-497/MACC1 axis in gastric cancer.Oncotarget. 2017 Jan 17;8(3):4125-4135. | ||||
| REF 21 | MicroRNA-497 suppresses cell proliferation and induces apoptosis through targeting PBX3 in human multiple myeloma. Am J Cancer Res. 2016 Dec 1;6(12):2880-2889. | ||||
| REF 22 | Twist promotes angiogenesis in pancreatic cancer by targeting miR-497/VEGFA axis.Oncotarget. 2016 May 3;7(18):25801-14. | ||||
If You Find Any Error in Data or Bug in Web Service, Please Kindly Report It to Dr. Zhou and Dr. Zhang.