miRNA Details
| miRNA General Information | |||||
|---|---|---|---|---|---|
| miRNA Mature ID | hsa-miR-503-5p | ||||
| miRNA Stemloop AC | MI0003188 | ||||
| miRNA Stemloop ID | hsa-mir-503 | ||||
| Sequence | uagcagcgggaacaguucugcag | ||||
| TTD Target(s) Regulated by This miRNA | Fibroblast growth factor receptor 1 (FGFR1) | Successful Target | Target Info | [1] | |
| Insulin-like growth factor I receptor (IGF1R) | Successful Target | Target Info | [2] | ||
| Apoptosis regulator Bcl-2 (BCL-2) | Successful Target | Target Info | [3] | ||
| Fibroblast growth factor-2 (FGF2) | Successful Target | Target Info | [4] | ||
| Vascular endothelial growth factor A (VEGFA) | Successful Target | Target Info | [4] | ||
| Checkpoint kinase-1 (CHK1) | Clinical trial Target | Target Info | [5] | ||
| Inhibitor of nuclear factor kappa-B kinase beta (IKKB) | Clinical trial Target | Target Info | [6] | ||
| Wee1-like protein kinase (WEE1) | Clinical trial Target | Target Info | [5] | ||
| CD40L receptor (CD40) | Clinical trial Target | Target Info | [7] | ||
| G1/S-specific cyclin-D1 (CCND1) | Clinical trial Target | Target Info | [8] | ||
| M-phase inducer phosphatase 1 (MPIP1) | Literature-reported Target | Target Info | [9] | ||
| G1/S-specific cyclin-E1 (CCNE1) | Literature-reported Target | Target Info | [10] | ||
| Fibroblast growth factor-8 (FGF8) | Literature-reported Target | Target Info | [11] | ||
| Cyclin D (CCND3) | Literature-reported Target | Target Info | [12] | ||
| F-box and WD-40 domain protein 7 (Fbxw7) | Literature-reported Target | Target Info | [13] | ||
| Melanoma differentiation-associated protein 6 (CDKN1A) | Literature-reported Target | Target Info | [5] | ||
| Osteoclast differentiation factor receptor (ODFR) | Literature-reported Target | Target Info | [14] | ||
| G1/S-specific cyclin-E2 (CCNE2) | Literature-reported Target | Target Info | [5] | ||
| Protein(s) Regulated by This miRNA | Anillin | Regulated Protein | [5] | ||
| Cyclic AMP-dependent transcription factor ATF-6 alpha | Regulated Protein | [5] | |||
| Cyclin-F | Regulated Protein | [5] | |||
| Dual specificity protein phosphatase CDC14A | Regulated Protein | [5] | |||
| Fanconi anemia group A protein | Regulated Protein | [16] | |||
| Phosphatidylinositol 3-kinase regulatory subunit alpha | Regulated Protein | [6] | |||
| Protein argonaute-1 | Regulated Protein | [5] | |||
| Rho guanine nucleotide exchange factor 19 | Regulated Protein | [18] | |||
| References | |||||
| REF 1 | An endothelial apelin-FGF link mediated by miR-424 and miR-503 is disrupted in pulmonary arterial hypertension. Nat Med. 2013 Jan;19(1):74-82. | ||||
| REF 2 | MicroRNA-503 acts as a tumor suppressor in glioblastoma for multiple antitumor effects by targeting IGF-1R. Oncol Rep. 2014 Mar;31(3):1445-52. | ||||
| REF 3 | miR-503 regulates the resistance of non-small cell lung cancer cells to cisplatin by targeting Bcl-2. Int J Mol Med. 2013 Sep;32(3):593-8. | ||||
| REF 4 | Transcriptome-wide identification of RNA-binding protein and microRNA target sites by PAR-CLIP. Cell. 2010 Apr 2;141(1):129-41. | ||||
| REF 5 | Induction of microRNAs, mir-155, mir-222, mir-424 and mir-503, promotes monocytic differentiation through combinatorial regulation. Leukemia. 2010 Feb;24(2):460-6. | ||||
| REF 6 | MiR-503 targets PI3K p85 and IKK- and suppresses progression of non-small cell lung cancer. Int J Cancer. 2014 Oct 1;135(7):1531-42. | ||||
| REF 7 | Investigation of the interaction between the MIR-503 and CD40 genes in irradiated U937 cells. Radiat Oncol. 2012 Mar 20;7:38. | ||||
| REF 8 | MicroRNA let-7b targets important cell cycle molecules in malignant melanoma cells and interferes with anchorage-independent growth. Cell Res. 2008 May;18(5):549-57. | ||||
| REF 9 | The let-7 microRNA represses cell proliferation pathways in human cells. Cancer Res. 2007 Aug 15;67(16):7713-22. | ||||
| REF 10 | miR-16 family induces cell cycle arrest by regulating multiple cell cycle genes. Nucleic Acids Res. 2008 Sep;36(16):5391-404. | ||||
| REF 11 | The oncoprotein HBXIP enhances angiogenesis and growth of breast cancer through modulating FGF8 and VEGF. Carcinogenesis. 2014 May;35(5):1144-53. | ||||
| REF 12 | MicroRNA-503 inhibits the G1/S transition by downregulating cyclin D3 and E2F3 in hepatocellular carcinoma. J Transl Med. 2013 Aug 22;11:195. | ||||
| REF 13 | Sequential expression of miR-182 and miR-503 cooperatively targets FBXW7, contributing to the malignant transformation of colon adenoma to adenocarcinoma. J Pathol. 2014 Dec;234(4):488-501. | ||||
| REF 14 | MiR-503 regulates osteoclastogenesis via targeting RANK. J Bone Miner Res. 2014 Feb;29(2):338-47. | ||||
| REF 15 | Induction of microRNAs, mir-155, mir-222, mir-424 and mir-503, promotes monocytic differentiation through combinatorial regulation. Leukemia. 2010 Feb;24(2):460-6. | ||||
| REF 16 | Epigenetic silencing of MicroRNA-503 regulates FANCA expression in non-small cell lung cancer cell.Biochem Biophys Res Commun. 2014 Feb 21;444(4):611-6. | ||||
| REF 17 | MiR-503 targets PI3K p85 and IKK- and suppresses progression of non-small cell lung cancer. Int J Cancer. 2014 Oct 1;135(7):1531-42. | ||||
| REF 18 | miR-503 regulates metastatic function through Rho guanine nucleotide exchanger factor 19 in hepatocellular carcinoma.J Surg Res. 2014 May 1;188(1):129-36. | ||||
If You Find Any Error in Data or Bug in Web Service, Please Kindly Report It to Dr. Zhou and Dr. Zhang.