Target Regulator(s) Information (MicroRNA)

Content Navigation (  All   None )                                      
Target General Information
The microRNAs (miRNAs) Regulating This Target
References
Target General Information  Top
Target ID T06093 Target Info
Target Name Rho-associated protein kinase 2 (ROCK2)
Synonyms p164 ROCK-2; Rho-associated, coiled-coil-containing protein kinase II; Rho-associated, coiled-coil-containing protein kinase 2; Rho kinase 2; ROCK-II; KIAA0619
Target Type Successful Target
Gene Name ROCK2
Biochemical Class Kinase
UniProt ID
O75116
The microRNAs (miRNAs) Regulating This Target  Top
miRNA Mature ID hsa-miR-142-3p miRNA Info
miRNA Mature AC
MIMAT0000434
Sequence uguaguguuuccuacuuuaugga
miRNA Species Homo sapiens
Evidence Score (E-score) 2 +
1 HITS-CLIP [1]
2 Luciferase Reporter Assay; qRT-PCR; Western Blot [2]
Representative Target(s) Regulated by This miRNA ATP-binding cassette transporter G2 (ABCG2) Target Info
ABCG2_HUMAN
High mobility group protein B1 (HMGB1) Target Info
HMGB1_HUMAN
miRNA Mature ID hsa-miR-200b-3p miRNA Info
miRNA Mature AC
MIMAT0000318
Sequence uaauacugccugguaaugauga
miRNA Species Homo sapiens
Regulation Mechanism ROCK2 is a direct target of miR-200b. [4]
Evidence Score (E-score) 2 +
1 Luciferase Reporter Assay [3]
2 Luciferase Reporter Assay [4]
Representative Target(s) Regulated by This miRNA Apoptosis regulator Bcl-2 (BCL-2) Target Info
BCL2_HUMAN
CDK inhibitor 1B p27Kip1 (CDKN1B) Target Info
CDN1B_HUMAN
miRNA Mature ID hsa-miR-124-3p miRNA Info
miRNA Mature AC
MIMAT0000422
Sequence uaaggcacgcggugaaugcc
miRNA Species Homo sapiens
Regulation Mechanism The overexpression of miR-124-3p by mature miRNA precursor transfection resulted in the decreased protein level of target ROCK2. [5]
Evidence Score (E-score) 1 +
1 Western Blot; qRT-PCR; Luciferase Reporter Assay [5]
Representative Target(s) Regulated by This miRNA Beta-secretase 1 (BACE1) Target Info
BACE1_HUMAN
Brain-derived neurotrophic factor (BDNF) Target Info
BDNF_HUMAN
miRNA Mature ID hsa-miR-139-5p miRNA Info
miRNA Mature AC
MIMAT0000250
Sequence ucuacagugcacgugucuccagu
miRNA Species Homo sapiens
Regulation Mechanism ROCK2 and miR-139-5p correlates negatively and the 3'UTR of ROCK has a suppressive effect on miR-139-5p. [6]
Evidence Score (E-score) 1 +
1 Luciferase Reporter Assay; Western Blot [6]
Representative Target(s) Regulated by This miRNA Apoptosis regulator Bcl-2 (BCL-2) Target Info
BCL2_HUMAN
C-X-C chemokine receptor type 4 (CXCR4) Target Info
CXCR4_HUMAN
miRNA Mature ID hsa-miR-144-5p miRNA Info
miRNA Mature AC
MIMAT0004600
Sequence ggauaucaucauauacuguaag
miRNA Species Homo sapiens
Regulation Mechanism ROCK2 is a direct downstream targets of miR-144. [7]
Evidence Score (E-score) 1 +
1 Luciferase Reporter Assay; Western Blot [7]
Representative Target(s) Regulated by This miRNA G1/S-specific cyclin-E1 (CCNE1) Target Info
CCNE1_HUMAN
G1/S-specific cyclin-E2 (CCNE2) Target Info
CCNE2_HUMAN
miRNA Mature ID hsa-miR-200c-3p miRNA Info
miRNA Mature AC
MIMAT0000617
Sequence uaauacugccggguaaugaugga
miRNA Species Homo sapiens
Regulation Mechanism ROCK2 is a direct target of miR-200c. [4]
Evidence Score (E-score) 1 +
1 Luciferase Reporter Assay [4]
Representative Target(s) Regulated by This miRNA Activin receptor type IIB (ACVR2B) Target Info
AVR2B_HUMAN
Apoptosis regulator Bcl-2 (BCL-2) Target Info
BCL2_HUMAN
miRNA Mature ID hsa-miR-138-5p miRNA Info
miRNA Mature AC
MIMAT0000430
Sequence agcugguguugugaaucaggccg
miRNA Species Homo sapiens
Regulation Mechanism The overexpression of miR-138-5p by mature miRNA mimics tranfection resulted in the decreased protein level of target ROCK2. [5]
Evidence Score (E-score) 1 +
1 Western Blot; qRT-PCR; Luciferase Reporter Assay [5]
Representative Target(s) Regulated by This miRNA Rho-associated protein kinase 2 (ROCK2) Target Info
ROCK2_HUMAN
References  Top
REF 1 Elucidation of transcriptome-wide microRNA binding sites in human cardiac tissues by Ago2 HITS-CLIP. Nucleic Acids Res. 2016 Sep 6;44(15):7120-31.
REF 2 MiR-142-3p attenuates the migration of CD4 T cells through regulating actin cytoskeleton via RAC1 and ROCK2 in arteriosclerosis obliterans. PLoS One. 2014 Apr 17;9(4):e95514.
REF 3 MiRNA-200b Regulates RMP7-Induced Increases in Blood-Tumor Barrier Permeability by Targeting RhoA and ROCKII. Front Mol Neurosci. 2016 Feb 5;9:9.
REF 4 Direct targeting of SUZ12/ROCK2 by miR-200b/c inhibits cholangiocarcinoma tumourigenesis and metastasis. Br J Cancer. 2013 Dec 10;109(12):3092-104.
REF 5 Downregulation of the Rho GTPase signaling pathway is involved in the microRNA-138-mediated inhibition of cell migration and invasion in tongue squamous cell carcinoma. Int J Cancer. 2010 Aug 1;127(3):505-12.
REF 6 Post-transcriptional regulation of the tumor suppressor miR-139-5p and a network of miR-139-5p-mediated mRNA interactions in colorectal cancer. FEBS J. 2014 Aug;281(16):3609-24.
REF 7 MicroRNA-144 suppresses osteosarcoma growth and metastasis by targeting ROCK1 and ROCK2. Oncotarget. 2015 Apr 30;6(12):10297-308.

If You Find Any Error in Data or Bug in Web Service, Please Kindly Report It to Dr. Zhou and Dr. Zhang.