Target Regulator(s) Information (MicroRNA)

Content Navigation (  All   None )                                      
Target General Information
The microRNAs (miRNAs) Regulating This Target
References
Target General Information  Top
Target ID T20302 Target Info
Target Name Autophagy-related protein 7 (ATG7)
Synonyms hAGP7; Ubiquitin-like modifier-activating enzyme ATG7; Ubiquitin-activating enzyme E1-like protein; ATG12-activating enzyme E1 ATG7; APG7L; APG7-like
Target Type Literature-reported Target
Gene Name ATG7
Biochemical Class Autophagy phagophore-formation transporter
UniProt ID
O95352
The microRNAs (miRNAs) Regulating This Target  Top
miRNA Mature ID hsa-miR-106a-5p miRNA Info
miRNA Mature AC
MIMAT0000103
Sequence aaaagugcuuacagugcagguag
miRNA Species Homo sapiens
Regulation Mechanism miR-106a downregulated ATG7 mRNA level by binding the specific sequence of ATG7 mRNA 3'UTR region. [1]
Evidence Score (E-score) 1 +
1 Luciferase Reporter Assay; Western Blot [1]
Representative Target(s) Regulated by This miRNA Amyloid beta A4 protein (APP) Target Info
A4_HUMAN
Apoptosis mediating surface antigen FAS (FAS) Target Info
TNR6_HUMAN
miRNA Mature ID hsa-miR-210-3p miRNA Info
miRNA Mature AC
MIMAT0000267
Sequence cugugcgugugacagcggcuga
miRNA Species Homo sapiens
Regulation Mechanism miR-210 directly regulates autophagy processes via targeting ATG7, and expression levels of miR-210 are inversely correlated with ATG7 expression in LFs. miR-210 directly targets ATG7 in LFs, leading to a modulating autophagy process. [2]
Evidence Score (E-score) 1 +
1 Luciferase Reporter Assay; Western Blot [2]
Representative Target(s) Regulated by This miRNA Activin receptor type IB (ACVR1B) Target Info
ACV1B_HUMAN
Autophagy-related protein 7 (ATG7) Target Info
ATG7_HUMAN
miRNA Mature ID hsa-miR-34a-5p miRNA Info
miRNA Mature AC
MIMAT0000255
Sequence uggcagugucuuagcugguugu
miRNA Species Homo sapiens
Regulation Mechanism miR-34a induces apoptosis along with a form of autophagy that inhibits prostate cancer cell proliferation by a mechanism independent of expression of ATG7. [3]
Evidence Score (E-score) 1 +
1 Western Blot [3]
Representative Target(s) Regulated by This miRNA Amphiregulin (AREG) Target Info
AREG_HUMAN
Androgen receptor (AR) Target Info
ANDR_HUMAN
References  Top
REF 1 miR-106a suppresses tumor cells death in colorectal cancer through targeting ATG7. Med Mol Morphol. 2017 Jun;50(2):76-85.
REF 2 Suppression of autophagy by extracellular vesicles promotes myofibroblast differentiation in COPD pathogenesis. J Extracell Vesicles. 2015 Nov 11;4:28388.
REF 3 Chitosan nanoparticle-mediated delivery of miRNA-34a decreases prostate tumor growth in the bone and its expression induces non-canonical autophagy. Oncotarget. 2015 Oct 6;6(30):29161-77.

If You Find Any Error in Data or Bug in Web Service, Please Kindly Report It to Dr. Zhou and Dr. Zhang.