Target Regulator(s) Information (MicroRNA)

Content Navigation (  All   None )                                      
Target General Information
The microRNAs (miRNAs) Regulating This Target
References
Target General Information  Top
Target ID T22274 Target Info
Target Name Histone deacetylase 6 (HDAC6)
Synonyms KIAA0901; JM21; HD6
Target Type Clinical trial Target
Gene Name HDAC6
Biochemical Class Carbon-nitrogen hydrolase
UniProt ID
Q9UBN7
The microRNAs (miRNAs) Regulating This Target  Top
miRNA Mature ID hsa-miR-22-3p miRNA Info
miRNA Mature AC
MIMAT0000077
Sequence aagcugccaguugaagaacugu
miRNA Species Homo sapiens
Regulation Mechanism Overexpression of miR-22 significantly decreased the activity of the luciferase reporter containing wide-type sequences of HDAC6 3'UTR, but had no obvious effect on the activity of the luciferase reporter containing mutant sequences. [2]
Evidence Score (E-score) 2 +
1 Luciferase Reporter Assay; qRT-PCR; Western Blot [1]
2 Luciferase Reporter Assay; Western Blot [2]
Representative Target(s) Regulated by This miRNA 5-HT 2C receptor (HTR2C) Target Info
5HT2C_HUMAN
ATP-citrate synthase (ACLY) Target Info
ACLY_HUMAN
miRNA Mature ID hsa-miR-433-3p miRNA Info
miRNA Mature AC
MIMAT0001627
Sequence aucaugaugggcuccucggugu
miRNA Species Homo sapiens
Regulation Mechanism The overexpression of miR-433-3p resulted in the decreased protein level of target HDAC6. [3]
Evidence Score (E-score) 1 +
1 Western Blot; Flow Cytometry [3]
Representative Target(s) Regulated by This miRNA cAMP-dependent chloride channel (CFTR) Target Info
CFTR_HUMAN
Cyclic AMP-responsive element-binding protein (CREB1) Target Info
CREB1_HUMAN
miRNA Mature ID hsa-miR-675-5p miRNA Info
miRNA Mature AC
MIMAT0004284
Sequence uggugcggagagggcccacagug
miRNA Species Homo sapiens
Regulation Mechanism miR-675 bound directly to the 3'UTR of class II HDAC6 and downregulated itsmRNA and protein levels. [4]
Evidence Score (E-score) 1 +
1 Luciferase Reporter Assay [4]
Representative Target(s) Regulated by This miRNA G-protein coupled receptor 55 (GPR55) Target Info
GPR55_HUMAN
Histone deacetylase 4 (HDAC4) Target Info
HDAC4_HUMAN
miRNA Mature ID hsa-miR-548m miRNA Info
miRNA Mature AC
MIMAT0005917
Sequence caaagguauuugugguuuuug
miRNA Species Homo sapiens
Evidence Score (E-score) 1 +
1 Luciferase Reporter Assay [5]
Representative Target(s) Regulated by This miRNA Histone deacetylase 6 (HDAC6) Target Info
HDAC6_HUMAN
References  Top
REF 1 Upregulation of miR-22 promotes osteogenic differentiation and inhibits adipogenic differentiation of human adipose tissue-derived mesenchymal stem cells by repressing HDAC6 protein expression. Stem Cells Dev. 2012 Sep 1;21(13):2531-40.
REF 2 MicroRNA-22 Promoted Osteogenic Differentiation of Human Periodontal Ligament Stem Cells by Targeting HDAC6. J Cell Biochem. 2017 Jul;118(7):1653-1658.
REF 3 A mutation in the 3'-UTR of the HDAC6 gene abolishing the post-transcriptional regulation mediated by hsa-miR-433 is linked to a new form of dominant X-linked chondrodysplasia. Hum Mol Genet. 2010 May 15;19(10):2015-27.
REF 4 Long Non-coding RNA H19 Inhibits Adipocyte Differentiation of Bone Marrow Mesenchymal Stem Cells through Epigenetic Modulation of Histone Deacetylases. Sci Rep. 2016 Jun 28;6:28897.
REF 5 A microenvironment-mediated c-Myc/miR-548m/HDAC6 amplification loop in non-Hodgkin B cell lymphomas. J Clin Invest. 2013 Nov;123(11):4612-26.

If You Find Any Error in Data or Bug in Web Service, Please Kindly Report It to Dr. Zhou and Dr. Zhang.