Target Regulator(s) Information (MicroRNA)

Content Navigation (  All   None )                                      
Target General Information
The microRNAs (miRNAs) Regulating This Target
References
Target General Information  Top
Target ID T29879 Target Info
Target Name Integrin alpha-5 (ITGA5)
Synonyms VLA-5; Integrin alpha-F; Integrin alpha-5 light chain; Integrin alpha-5 heavy chain; Fibronectin receptor subunit alpha; FNRA; CD49e antigen; CD49e; CD49 antigen-like family member E
Target Type Clinical trial Target
Gene Name ITGA5
Biochemical Class Integrin
UniProt ID
P08648
The microRNAs (miRNAs) Regulating This Target  Top
miRNA Mature ID hsa-miR-31-5p miRNA Info
miRNA Mature AC
MIMAT0000089
Sequence aggcaagaugcuggcauagcu
miRNA Species Homo sapiens
Regulation Mechanism The overexpression of miR-31-5p resulted in the decreased protein level of target ITGA5. [4]
Evidence Score (E-score) 4 +
1 Luciferase Reporter Assay [1]
2 Luciferase Reporter Assay; qRT-PCR; Western Blot [2]
3 Luciferase Reporter Assay; qRT-PCR; Western Blot [3]
4 Luciferase Reporter Assay; qRT-PCR; Western Blot [4]
Representative Target(s) Regulated by This miRNA Cyclin-dependent kinase 1 (CDK1) Target Info
CDK1_HUMAN
Dickkopf-related protein 1 (DKK1) Target Info
DKK1_HUMAN
miRNA Mature ID hsa-miR-148b-3p miRNA Info
miRNA Mature AC
MIMAT0000759
Sequence ucagugcaucacagaacuuugu
miRNA Species Homo sapiens
Regulation Mechanism miR-148b is a major coordinator of breast cancer progression in a relapse-associated microRNA signature by targeting ROCK1. [5]
Evidence Score (E-score) 2 +
1 Luciferase Reporter Assay [5]
2 Western Blot [6]
Representative Target(s) Regulated by This miRNA Activated leukocyte cell adhesionmolecule (ALCAM) Target Info
CD166_HUMAN
Activin receptor-like kinase 2 (ALK-2) Target Info
ACVR1_HUMAN
miRNA Mature ID hsa-miR-205-5p miRNA Info
miRNA Mature AC
MIMAT0000266
Sequence uccuucauuccaccggagucug
miRNA Species Homo sapiens
Evidence Score (E-score) 2 +
1 Immunohistochemistry; Luciferase Reporter Assay; Western Blot [7]
2 qRT-PCR [8]
Representative Target(s) Regulated by This miRNA Androgen receptor (AR) Target Info
ANDR_HUMAN
Apoptosis regulator Bcl-2 (BCL-2) Target Info
BCL2_HUMAN
miRNA Mature ID hsa-miR-148a-3p miRNA Info
miRNA Mature AC
MIMAT0000243
Sequence ucagugcacuacagaacuuugu
miRNA Species Homo sapiens
Evidence Score (E-score) 1 +
1 Luciferase Reporter Assay [9]
Representative Target(s) Regulated by This miRNA Activated leukocyte cell adhesionmolecule (ALCAM) Target Info
CD166_HUMAN
Activin receptor-like kinase 2 (ALK-2) Target Info
ACVR1_HUMAN
miRNA Mature ID hsa-miR-152-3p miRNA Info
miRNA Mature AC
MIMAT0000438
Sequence ucagugcaugacagaacuugg
miRNA Species Homo sapiens
Regulation Mechanism The downregulation of miR-152 putative target, was also possible confirmed at the protein level, in fact a western blot analysis showed a decrease of itga5 protein level in HDFn cells from p1 to p16. [10]
Evidence Score (E-score) 1 +
1 Luciferase Reporter Assay; Western Blot [10]
Representative Target(s) Regulated by This miRNA Activated leukocyte cell adhesionmolecule (ALCAM) Target Info
CD166_HUMAN
Dickkopf-related protein 1 (DKK1) Target Info
DKK1_HUMAN
miRNA Mature ID hsa-miR-17-3p miRNA Info
miRNA Mature AC
MIMAT0000071
Sequence acugcagugaaggcacuuguag
miRNA Species Homo sapiens
Regulation Mechanism miR-17 bound directly to the 3'UTR of ITGA5 and suppressed its expression. [11]
Evidence Score (E-score) 1 +
1 Luciferase Reporter Assay; Western Blot [11]
Representative Target(s) Regulated by This miRNA E-selectin (SELE) Target Info
LYAM2_HUMAN
Integrin alpha-5 (ITGA5) Target Info
ITA5_HUMAN
miRNA Mature ID hsa-miR-330-5p miRNA Info
miRNA Mature AC
MIMAT0004693
Sequence ucucugggccugugucuuaggc
miRNA Species Homo sapiens
Regulation Mechanism ITGA5 is a target of miR-330-5p. [12]
Evidence Score (E-score) 1 +
1 Luciferase Reporter Assay; Western Blot [12]
Representative Target(s) Regulated by This miRNA Integrin alpha-5 (ITGA5) Target Info
ITA5_HUMAN
Mucin-1 (MUC1) Target Info
MUC1_HUMAN
miRNA Mature ID hsa-miR-92a-3p miRNA Info
miRNA Mature AC
MIMAT0000092
Sequence uauugcacuugucccggccugu
miRNA Species Homo sapiens
Regulation Mechanism The overexpression of miR-92a-3p by mature miRNA precursor transfection resulted in the decreased protein level of target ITGA5. [4]
Evidence Score (E-score) 1 +
1 Western Blot; Luciferase Reporter Assay [4]
Representative Target(s) Regulated by This miRNA Integrin alpha-5 (ITGA5) Target Info
ITA5_HUMAN
References  Top
REF 1 MicroRNA-31 functions as a tumor suppressor and increases sensitivity to mitomycin-C in urothelial bladder cancer by targeting integrin 5. Oncotarget. 2016 May 10;7(19):27445-57.
REF 2 Upregulation of microRNA-31 targeting integrin 5 suppresses tumor cell invasion and metastasis by indirectly regulating PI3K/AKT pathway in human gastric cancer SGC7901 cells. Tumour Biol. 2016 Jun;37(6):8317-25.
REF 3 A pleiotropically acting microRNA, miR-31, inhibits breast cancer metastasis. Cell. 2009 Jun 12;137(6):1032-46.
REF 4 MicroRNA-92a controls angiogenesis and functional recovery of ischemic tissues in mice. Science. 2009 Jun 26;324(5935):1710-3.
REF 5 miR148b is a major coordinator of breast cancer progression in a relapse-associated microRNA signature by targeting ITGA5, ROCK1, PIK3CA, NRAS, and CSF1. FASEB J. 2013 Mar;27(3):1223-35.
REF 6 Down-regulation of miR-21 biogenesis by estrogen action contributes to osteoclastic apoptosis. J Cell Biochem. 2013 Jun;114(6):1217-22.
REF 7 TMPRSS4 regulates levels of integrin 5 in NSCLC through miR-205 activity to promote metastasis. Br J Cancer. 2014 Feb 4;110(3):764-74.
REF 8 Integrin alpha5 down-regulation by miR-205 suppresses triple negative breast cancer stemness and metastasis by inhibiting the Src/Vav2/Rac1 pathway. Cancer Lett. 2018 Oct 1;433:199-209.
REF 9 Integrative network analysis reveals active microRNAs and their functions in gastric cancer. BMC Syst Biol. 2011 Jun 26;5:99.
REF 10 MicroRNA-152 and -181a participate in human dermal fibroblasts senescence acting on cell adhesion and remodeling of the extra-cellular matrix. Aging (Albany NY). 2012 Nov;4(11):843-53.
REF 11 miR-17 inhibits ovarian cancer cell peritoneal metastasis by targeting ITGA5 and ITGB1. Oncol Rep. 2016 Oct;36(4):2177-83.
REF 12 miR-330-5p suppresses glioblastoma cell proliferation and invasiveness through targeting ITGA5. Biosci Rep. 2017 Jun 21;37(3). pii: BSR20170019.

If You Find Any Error in Data or Bug in Web Service, Please Kindly Report It to Dr. Zhou and Dr. Zhang.