Content Navigation
( All
None )
Target General Information |
Top |
Target ID |
T62998 |
Target Info
|
Target Name |
Scavenger receptor class B member 1 (SCARB1) |
Synonyms |
SRB1; SR-BI; Collagen type I receptor, thrombospondin receptor-like 1; CLA1; CLA-1; CD36L1; CD36 antigen-like 1; CD36 and LIMPII analogous 1; CD36 |
Target Type |
Literature-reported Target |
Gene Name |
SCARB1 |
Biochemical Class |
Long chain fatty acid translocase |
UniProt ID |
|
The microRNAs (miRNAs) Regulating This Target |
Top |
miRNA Mature ID |
hsa-miR-223-3p |
miRNA Info
|
miRNA Mature AC |
|
Sequence |
ugucaguuugucaaauacccca
|
miRNA Species |
Homo sapiens |
Evidence Score (E-score) |
2 |
+ |
1 |
Luciferase Reporter Assay |
[1] |
2 |
RT-PCR |
[2] |
Representative Target(s) Regulated by This miRNA |
ATM serine/threonine kinase (ATM)
|
Target Info
|
|
C-X-C motif chemokine 2 (CXCL2)
|
Target Info
|
|
miRNA Mature ID |
hsa-miR-185-5p |
miRNA Info
|
miRNA Mature AC |
|
Sequence |
uggagagaaaggcaguuccuga
|
miRNA Species |
Homo sapiens |
Evidence Score (E-score) |
1 |
+ |
1 |
Luciferase Reporter Assay |
[1] |
Representative Target(s) Regulated by This miRNA |
Androgen receptor (AR)
|
Target Info
|
|
Arachidonate 12-lipoxygenase (12-LOX)
|
Target Info
|
|
miRNA Mature ID |
hsa-miR-96-5p |
miRNA Info
|
miRNA Mature AC |
|
Sequence |
uuuggcacuagcacauuuuugcu
|
miRNA Species |
Homo sapiens |
Evidence Score (E-score) |
1 |
+ |
1 |
Luciferase Reporter Assay |
[1] |
Representative Target(s) Regulated by This miRNA |
5-HT 1B receptor (HTR1B)
|
Target Info
|
|
ALK tyrosine kinase receptor (ALK)
|
Target Info
|
|
References |
Top |
REF 1 |
MicroRNAs 185, 96, and 223 repress selective high-density lipoprotein cholesterol uptake through posttranscriptional inhibition. Mol Cell Biol. 2013 May;33(10):1956-64.
|
REF 2 |
MicroRNA-223 coordinates cholesterol homeostasis. Proc Natl Acad Sci U S A. 2014 Oct 7;111(40):14518-23.
|
If You Find Any Error in Data or Bug in Web Service, Please Kindly Report It to Dr. Zhou and Dr. Zhang.