Target Regulator(s) Information (MicroRNA)

Content Navigation (  All   None )                                      
Target General Information
The microRNAs (miRNAs) Regulating This Target
References
Target General Information  Top
Target ID T64205 Target Info
Target Name Signal transducer and activator of transcription 1 (STAT1)
Synonyms Transcription factor ISGF-3 components p91/p84; Signal transducers and activators of transcription factor; Signal transducer and activator of transcription 1-alpha/beta; STAT-1; P91
Target Type Patented-recorded Target
Gene Name STAT1
Biochemical Class Transcription factor
UniProt ID
P42224
The microRNAs (miRNAs) Regulating This Target  Top
miRNA Mature ID hsa-miR-146a-5p miRNA Info
miRNA Mature AC
MIMAT0000449
Sequence ugagaacugaauuccauggguu
miRNA Species Homo sapiens
Regulation Mechanism The overexpression of miR-146a-5p by mature miRNA precursor transfection resulted in the decreased protein level of target STAT1. [2]
Evidence Score (E-score) 4 +
1 Luciferase Reporter Assay [1]
2 Luciferase Reporter Assay [2]
3 Luciferase Reporter Assay; qRT-PCR; Western Blot [3]
4 qRT-PCR; Western Blot [4]
Representative Target(s) Regulated by This miRNA Activation B7-1 antigen (CD80) Target Info
CD80_HUMAN
Apoptosis mediating surface antigen FAS (FAS) Target Info
TNR6_HUMAN
miRNA Mature ID hsa-miR-145-5p miRNA Info
miRNA Mature AC
MIMAT0000437
Sequence guccaguuuucccaggaaucccu
miRNA Species Homo sapiens
Regulation Mechanism Overexpression of miR-145 resulted in decreased luciferase activity, indicating that the miRNA can bind STAT1 cDNA and directly mediate repression. [5]
Evidence Score (E-score) 2 +
1 Luciferase Reporter Assay; Western Blot [5]
2 qRT-PCR [6]
Representative Target(s) Regulated by This miRNA A proliferation-inducing ligand (APRIL) Target Info
TNF13_HUMAN
Alkaline phosphatase (ALPPL2) Target Info
PPBN_HUMAN
miRNA Mature ID hsa-miR-150-5p miRNA Info
miRNA Mature AC
MIMAT0000451
Sequence ucucccaacccuuguaccagug
miRNA Species Homo sapiens
Regulation Mechanism STAT1 is a target of miR-150. [7]
Evidence Score (E-score) 2 +
1 Luciferase Reporter Assay; Western Blot [7]
2 Luciferase Reporter Assay; Western Blot [8]
Representative Target(s) Regulated by This miRNA Apoptosis inhibitor survivin (BIRC5) Target Info
BIRC5_HUMAN
Beta-arrestin-2 (ARRB2) Target Info
ARRB2_HUMAN
miRNA Mature ID hsa-miR-140-5p miRNA Info
miRNA Mature AC
MIMAT0000431
Sequence cagugguuuuacccuaugguag
miRNA Species Homo sapiens
Regulation Mechanism miR-140-5p inhibits Th1 differentiation through down-regulation of STAT1. [9]
Evidence Score (E-score) 1 +
1 Luciferase Reporter Assay; Western Blot [9]
Representative Target(s) Regulated by This miRNA Adenosine deaminase (ADA) Target Info
ADA_HUMAN
Aspartyl aminopeptidase (DNPEP) Target Info
DNPEP_HUMAN
miRNA Mature ID hsa-miR-155-5p miRNA Info
miRNA Mature AC
MIMAT0000646
Sequence uuaaugcuaaucgugauagggguu
miRNA Species Homo sapiens
Regulation Mechanism miR-155 targets STAT1 and consequently modulates the miR-124/iASPP/p63 pathway. [10]
Evidence Score (E-score) 1 +
1 Luciferase Reporter Assay; Western Blot [10]
Representative Target(s) Regulated by This miRNA Acetyl-CoA transporter (SLC33A1) Target Info
ACATN_HUMAN
Angiotensin II receptor type-1 (AGTR1) Target Info
AGTR1_HUMAN
miRNA Mature ID hsa-miR-203a-3p miRNA Info
miRNA Mature AC
MIMAT0000264
Sequence gugaaauguuuaggaccacuag
miRNA Species Homo sapiens
Regulation Mechanism Overexpression of miR203 in HEK293T cells downregulated luciferase activity of the STAT1-driven wild-type reporter constructs. [11]
Evidence Score (E-score) 1 +
1 Luciferase Reporter Assay [11]
Representative Target(s) Regulated by This miRNA Apoptosis inhibitor survivin (BIRC5) Target Info
BIRC5_HUMAN
Apoptosis regulator Bcl-W (BCL-W) Target Info
B2CL2_HUMAN
miRNA Mature ID hsa-miR-223-3p miRNA Info
miRNA Mature AC
MIMAT0000280
Sequence ugucaguuugucaaauacccca
miRNA Species Homo sapiens
Regulation Mechanism STAT1 is a target of miR-233. [7]
Evidence Score (E-score) 1 +
1 Luciferase Reporter Assay; Western Blot [7]
Representative Target(s) Regulated by This miRNA ATM serine/threonine kinase (ATM) Target Info
ATM_HUMAN
C-X-C motif chemokine 2 (CXCL2) Target Info
CXCL2_HUMAN
References  Top
REF 1 MicroRNA-146a feedback suppresses T cell immune function by targeting Stat1 in patients with chronic hepatitis B. J Immunol. 2013 Jul 1;191(1):293-301.
REF 2 MicroRNA-146A contributes to abnormal activation of the type I interferon pathway in human lupus by targeting the key signaling proteins. Arthritis Rheum. 2009 Apr;60(4):1065-75.
REF 3 miR146a impairs the IFN-induced anti-HBV immune response by downregulating STAT1 in hepatocytes. Liver Int. 2014 Jan;34(1):58-68.
REF 4 miR-146a suppresses cellular immune response during Japanese encephalitis virus JaOArS982 strain infection in human microglial cells. J Neuroinflammation. 2015 Feb 18;12:30.
REF 5 MicroRNA-145 targets YES and STAT1 in colon cancer cells. PLoS One. 2010 Jan 21;5(1):e8836.
REF 6 Profiling of gallbladder carcinoma reveals distinct miRNA profiles and activation of STAT1 by the tumor suppressive miRNA-145-5p. Sci Rep. 2019 Mar 18;9(1):4796.
REF 7 STAT1: A Novel Target of miR-150 and miR-223 Is Involved in the Proliferation of HTLV-I-Transformed and ATL Cells. Neoplasia. 2015 May;17(5):449-62.
REF 8 miR-181a and miR-150 regulate dendritic cell immune inflammatory responses and cardiomyocyte apoptosis via targeting JAK1-STAT1/c-Fos pathway. J Cell Mol Med. 2017 Nov;21(11):2884-2895.
REF 9 Inverse correlation of expression of microRNA-140-5p with progression of multiple sclerosis and differentiation of encephalitogenic T helper type 1 cells. Immunology. 2016 Apr;147(4):488-98.
REF 10 The miR-124-p63 feedback loop modulates colorectal cancer growth. Oncotarget. 2017 Apr 25;8(17):29101-29115.
REF 11 MiRNA203 suppresses the expression of protumorigenic STAT1 in glioblastoma to inhibit tumorigenesis. Oncotarget. 2016 Dec 20;7(51):84017-84029.

If You Find Any Error in Data or Bug in Web Service, Please Kindly Report It to Dr. Zhou and Dr. Zhang.