Target Regulator(s) Information (MicroRNA)

Content Navigation (  All   None )                                      
Target General Information
The microRNAs (miRNAs) Regulating This Target
References
Target General Information  Top
Target ID T65501 Target Info
Target Name DNA [cytosine-5]-methyltransferase 3B (DNMT3B)
Synonyms M.HsaIIIB; Dnmt3b; DNA methyltransferase HsaIIIB; DNA methyltransferase 3B; DNA MTase HsaIIIB; DNA (cytosine-5)-methyltransferase 3B
Target Type Clinical trial Target
Gene Name DNMT3B
Biochemical Class Methyltransferase
UniProt ID
Q9UBC3
The microRNAs (miRNAs) Regulating This Target  Top
miRNA Mature ID hsa-miR-29a-3p miRNA Info
miRNA Mature AC
MIMAT0000086
Sequence uagcaccaucugaaaucgguua
miRNA Species Homo sapiens
Evidence Score (E-score) 3 +
1 ChIP; qRT-PCR; Western Blot [1]
2 ChIP; qRT-PCR; Western Blot [2]
3 Microarray; qRT-PCR [3]
Representative Target(s) Regulated by This miRNA Apoptosis regulator Bcl-2 (BCL-2) Target Info
BCL2_HUMAN
Aryl hydrocarbon receptor (AHR) Target Info
AHR_HUMAN
miRNA Mature ID hsa-miR-148a-3p miRNA Info
miRNA Mature AC
MIMAT0000243
Sequence ucagugcacuacagaacuuugu
miRNA Species Homo sapiens
Regulation Mechanism The overexpression of miR-148a-3p by mature miRNA precursor transfection resulted in the decreased protein level of target DNMT3B. [2]
Evidence Score (E-score) 3 +
1 GFP Reporter Assay; Western Blot; qRT-PCR [4]
2 Microarray; qRT-PCR [5]
3 Microarray; qRT-PCR [2]
Representative Target(s) Regulated by This miRNA Activated leukocyte cell adhesionmolecule (ALCAM) Target Info
CD166_HUMAN
Activin receptor-like kinase 2 (ALK-2) Target Info
ACVR1_HUMAN
miRNA Mature ID hsa-miR-200c-3p miRNA Info
miRNA Mature AC
MIMAT0000617
Sequence uaauacugccggguaaugaugga
miRNA Species Homo sapiens
Regulation Mechanism Ectopic expression of miR-200a in gastric cancer cells impaired proliferation and invasion through direct targeting of DNMT3B expression indirectly via down-regulation of SP1. [6]
Evidence Score (E-score) 2 +
1 In Situ Hybridization; Luciferase Reporter Assay; Western Blot [6]
2 Luciferase Reporter Assay [7]
Representative Target(s) Regulated by This miRNA Activin receptor type IIB (ACVR2B) Target Info
AVR2B_HUMAN
Apoptosis regulator Bcl-2 (BCL-2) Target Info
BCL2_HUMAN
miRNA Mature ID hsa-miR-148b-3p miRNA Info
miRNA Mature AC
MIMAT0000759
Sequence ucagugcaucacagaacuuugu
miRNA Species Homo sapiens
Regulation Mechanism The overexpression of miR-148b-3p by mature miRNA precursor transfection resulted in the decreased protein level of target DNMT3B. [2]
Evidence Score (E-score) 1 +
1 Western Blot [2]
Representative Target(s) Regulated by This miRNA Activated leukocyte cell adhesionmolecule (ALCAM) Target Info
CD166_HUMAN
Activin receptor-like kinase 2 (ALK-2) Target Info
ACVR1_HUMAN
miRNA Mature ID hsa-miR-200b-3p miRNA Info
miRNA Mature AC
MIMAT0000318
Sequence uaauacugccugguaaugauga
miRNA Species Homo sapiens
Regulation Mechanism Ectopic expression of miR-200b in gastric cancer cells impaired proliferation and invasion through direct targeting of DNMT3B expression indirectly via down-regulation of SP1. [6]
Evidence Score (E-score) 1 +
1 In Situ Hybridization; Luciferase Reporter Assay; Western Blot [6]
Representative Target(s) Regulated by This miRNA Apoptosis regulator Bcl-2 (BCL-2) Target Info
BCL2_HUMAN
CDK inhibitor 1B p27Kip1 (CDKN1B) Target Info
CDN1B_HUMAN
miRNA Mature ID hsa-miR-29b-3p miRNA Info
miRNA Mature AC
MIMAT0000100
Sequence uagcaccauuugaaaucaguguu
miRNA Species Homo sapiens
Regulation Mechanism The overexpression of miR-29b-3p by mature miRNA precursor transfection resulted in the decreased protein level of target DNMT3B. [2]
Evidence Score (E-score) 1 +
1 qRT-PCR [2]
Representative Target(s) Regulated by This miRNA Beta-secretase 1 (BACE1) Target Info
BACE1_HUMAN
Cyclin-dependent kinase 6 (CDK6) Target Info
CDK6_HUMAN
miRNA Mature ID hsa-miR-29c-3p miRNA Info
miRNA Mature AC
MIMAT0000681
Sequence uagcaccauuugaaaucgguua
miRNA Species Homo sapiens
Evidence Score (E-score) 1 +
1 Luciferase Reporter Assay; Western Blot; qRT-PCR; Reporter Assay [2]
Representative Target(s) Regulated by This miRNA Apoptosis regulator Bcl-2 (BCL-2) Target Info
BCL2_HUMAN
B7 homolog 3 (CD276) Target Info
CD276_HUMAN
miRNA Mature ID hsa-miR-29c-5p miRNA Info
miRNA Mature AC
MIMAT0004673
Sequence ugaccgauuucuccugguguuc
miRNA Species Homo sapiens
Regulation Mechanism DNA methyltransferase 3b are the target gene of miR-29c. [8]
Evidence Score (E-score) 1 +
1 Immunohistochemistry; Western Blot [8]
Representative Target(s) Regulated by This miRNA DNA [cytosine-5]-methyltransferase 3A (DNMT3A) Target Info
DNM3A_HUMAN
DNA [cytosine-5]-methyltransferase 3B (DNMT3B) Target Info
DNM3B_HUMAN
miRNA Mature ID hsa-miR-369-5p miRNA Info
miRNA Mature AC
MIMAT0001621
Sequence agaucgaccguguuauauucgc
miRNA Species Homo sapiens
Evidence Score (E-score) 1 +
1 Luciferase Reporter Assay; Western Blot [9]
Representative Target(s) Regulated by This miRNA DNA [cytosine-5]-methyltransferase 3A (DNMT3A) Target Info
DNM3A_HUMAN
DNA [cytosine-5]-methyltransferase 3B (DNMT3B) Target Info
DNM3B_HUMAN
References  Top
REF 1 Involvement of miRNA-29a in epigenetic regulation of transforming growth factor--induced epithelial-mesenchymal transition in hepatocellular carcinoma. Hepatol Res. 2014 Aug;44(8):907-19.
REF 2 MicroRNA-29 family reverts aberrant methylation in lung cancer by targeting DNA methyltransferases 3A and 3B. Proc Natl Acad Sci U S A. 2007 Oct 2;104(40):15805-10.
REF 3 Potential roles of microRNA-29a in the molecular pathophysiology of T-cell acute lymphoblastic leukemia. Cancer Sci. 2015 Oct;106(10):1264-77.
REF 4 miR-148 targets human DNMT3b protein coding region. RNA. 2008 May;14(5):872-7.
REF 5 MicroRNA expression profiles in umbilical cord blood cell lineages. Stem Cells Dev. 2010 Jan;19(1):17-26.
REF 6 miR-200b and miR-200c as prognostic factors and mediators of gastric cancer cell progression. Clin Cancer Res. 2013 Oct 15;19(20):5602-12.
REF 7 Autocrine TGF-beta1/miR-200s/miR-221/DNMT3B regulatory loop maintains CAF status to fuel breast cancer cell proliferation. Cancer Lett. 2019 Jun 28;452:79-89.
REF 8 MiR-29c regulates the expression of miR-34c and miR-449a by targeting DNA methyltransferase 3a and 3b in nasopharyngeal carcinoma. BMC Cancer. 2016 Mar 15;16:218.
REF 9 Adipogenic differentiation of human mesenchymal stromal cells is down-regulated by microRNA-369-5p and up-regulated by microRNA-371. J Cell Physiol. 2011 Sep;226(9):2226-34.

If You Find Any Error in Data or Bug in Web Service, Please Kindly Report It to Dr. Zhou and Dr. Zhang.