Target Regulator(s) Information (MicroRNA)

Content Navigation (  All   None )                                      
Target General Information
The microRNAs (miRNAs) Regulating This Target
References
Target General Information  Top
Target ID T67658 Target Info
Target Name Glucose transporter type 4 (SLC2A4)
Synonyms Solute carrier family 2, facilitated glucose transporter member 4; Glut4 protein; Glucose transporter type 4, insulin-responsive; GLUT4; GLUT-4
Target Type Clinical trial Target
Gene Name SLC2A4
Biochemical Class Major facilitator
UniProt ID
P14672
The microRNAs (miRNAs) Regulating This Target  Top
miRNA Mature ID hsa-miR-93-5p miRNA Info
miRNA Mature AC
MIMAT0000093
Sequence caaagugcuguucgugcagguag
miRNA Species Homo sapiens
Regulation Mechanism Overexpression of miR-93 resulted in downregulation of GLUT4 gene expression in adipocytes through direct targeting of the GLUT4 3`UTR, while inhibition of miR-93 activity led to increased GLUT4 expression. [1]
Evidence Score (E-score) 2 +
1 Luciferase Reporter Assay; Western Blot [1]
2 Western Blot [2]
Representative Target(s) Regulated by This miRNA Angiogenin (ANG) Target Info
ANGI_HUMAN
ATP-binding cassette transporter A1 (ABCA1) Target Info
ABCA1_HUMAN
miRNA Mature ID hsa-miR-106b-5p miRNA Info
miRNA Mature AC
MIMAT0000680
Sequence uaaagugcugacagugcagau
miRNA Species Homo sapiens
Regulation Mechanism miR-106b targets GLUT4 to regluate glucose metabolism in skeletal muscles. [3]
Evidence Score (E-score) 1 +
1 LacZ Reporter Assay [3]
Representative Target(s) Regulated by This miRNA Amyloid beta A4 protein (APP) Target Info
A4_HUMAN
Apoptosis mediating surface antigen FAS (FAS) Target Info
TNR6_HUMAN
miRNA Mature ID hsa-miR-223-3p miRNA Info
miRNA Mature AC
MIMAT0000280
Sequence ugucaguuugucaaauacccca
miRNA Species Homo sapiens
Regulation Mechanism miRNAs can upregulate target SLC2A4 in terminally differentiated cardiomyocytes. [4]
Evidence Score (E-score) 1 +
1 Luciferase Reporter Assay; Northern Blot [4]
Representative Target(s) Regulated by This miRNA ATM serine/threonine kinase (ATM) Target Info
ATM_HUMAN
C-X-C motif chemokine 2 (CXCL2) Target Info
CXCL2_HUMAN
References  Top
REF 1 miRNA-93 inhibits GLUT4 and is overexpressed in adipose tissue of polycystic ovary syndrome patients and women with insulin resistance. Diabetes. 2013 Jul;62(7):2278-86.
REF 2 Diabetes Modulates MicroRNAs 29b-3p, 29c-3p, 199a-5p and 532-3p Expression in Muscle: Possible Role in GLUT4 and HK2 Repression. Front Endocrinol (Lausanne). 2018 Sep 12;9:536.
REF 3 Regulation of Insulin Resistance by Multiple MiRNAs via Targeting the GLUT4 Signalling Pathway. Cell Physiol Biochem. 2016;38(5):2063-78.
REF 4 MicroRNA-223 regulates Glut4 expression and cardiomyocyte glucose metabolism. Cardiovasc Res. 2010 Jun 1;86(3):410-20.

If You Find Any Error in Data or Bug in Web Service, Please Kindly Report It to Dr. Zhou and Dr. Zhang.