Target Regulator(s) Information (MicroRNA)
Target General Information | Top | ||||
---|---|---|---|---|---|
Target ID | T74456 | Target Info | |||
Target Name | Angiotensin II receptor type-1 (AGTR1) | ||||
Synonyms | Type-1 angiotensin II receptor; Angiotensin II type-1 receptor; Angiotensin II receptor 1; Angiotensin 1 receptor; AT2R1B; AT2R1; AT1BR; AT1AR; AT1; AGTR1B; AGTR1A | ||||
Target Type | Successful Target | ||||
Gene Name | AGTR1 | ||||
Biochemical Class | GPCR rhodopsin | ||||
UniProt ID |
The microRNAs (miRNAs) Regulating This Target | Top | ||||
---|---|---|---|---|---|
miRNA Mature ID | hsa-miR-155-5p | miRNA Info | |||
miRNA Mature AC | |||||
Sequence | uuaaugcuaaucgugauaggggu | ||||
miRNA Species | Homo sapiens | ||||
Regulation Mechanism | The mutation of miR-155-5p resulted in the unchanged mRNA level of target AGTR1; The overexpression by mature miRNA transfection resulted in the unchanged mRNA level of target AGTR1. | [4] | |||
Evidence Score (E-score) | 7 | + | |||
Representative Target(s) Regulated by This miRNA | Acetyl-CoA transporter (SLC33A1) | Target Info | |||
Angiotensin II receptor type-1 (AGTR1) | Target Info | ||||
miRNA Mature ID | hsa-miR-34a-5p | miRNA Info | |||
miRNA Mature AC | |||||
Sequence | uggcagugucuuagcugguugu | ||||
miRNA Species | Homo sapiens | ||||
Evidence Score (E-score) | 1 | + | |||
Representative Target(s) Regulated by This miRNA | Amphiregulin (AREG) | Target Info | |||
Androgen receptor (AR) | Target Info | ||||
miRNA Mature ID | hsa-miR-410-3p | miRNA Info | |||
miRNA Mature AC | |||||
Sequence | aauauaacacagauggccugu | ||||
miRNA Species | Homo sapiens | ||||
Regulation Mechanism | miR-410 downregulates AGTR1 expression via direct interaction with its 3'UTR. | [9] | |||
Evidence Score (E-score) | 1 | + | |||
Representative Target(s) Regulated by This miRNA | Angiotensin II receptor type-1 (AGTR1) | Target Info | |||
G2/mitotic-specific cyclin B1 (CCNB1) | Target Info |
References | Top | ||||
---|---|---|---|---|---|
REF 1 | MicroRNA-mediated regulation of gene expression is affected by disease-associated SNPs within the 3'-UTR via altered RNA structure. RNA Biol. 2012 Jun;9(6):924-37. | ||||
REF 2 | Hodgkin lymphoma cell lines are characterized by a specific miRNA expression profile. Neoplasia. 2009 Feb;11(2):167-76. | ||||
REF 3 | Human microRNA-155 on chromosome 21 differentially interacts with its polymorphic target in the AGTR1 3' untranslated region: a mechanism for functional single-nucleotide polymorphisms related to phenotypes. Am J Hum Genet. 2007 Aug;81(2):405-13. | ||||
REF 4 | MicroRNA-155 regulates human angiotensin II type 1 receptor expression in fibroblasts. J Biol Chem. 2006 Jul 7;281(27):18277-84. | ||||
REF 5 | Endothelial enriched microRNAs regulate angiotensin II-induced endothelial inflammation and migration. Atherosclerosis. 2011 Apr;215(2):286-93. | ||||
REF 6 | MicroRNA-155 regulates angiotensin II type 1 receptor expression and phenotypic differentiation in vascular adventitial fibroblasts. Biochem Biophys Res Commun. 2010 Oct 1;400(4):483-8. | ||||
REF 7 | The human angiotensin II type 1 receptor +1166 A/C polymorphism attenuates microRNA-155 binding. J Biol Chem. 2007 Aug 17;282(33):24262-9. | ||||
REF 8 | The miR-34a-5p promotes the multi-chemoresistance of osteosarcoma via repression of the AGTR1 gene. BMC Cancer. 2017 Jan 10;17(1):45. | ||||
REF 9 | MicroRNA-410 functions as a tumor suppressor by targeting angiotensin II type 1 receptor in pancreatic cancer. IUBMB Life. 2015 Jan;67(1):42-53. |
If You Find Any Error in Data or Bug in Web Service, Please Kindly Report It to Dr. Zhou and Dr. Zhang.