Target Regulator(s) Information (MicroRNA)
| Target General Information | Top | ||||
|---|---|---|---|---|---|
| Target ID | T74570 | Target Info | |||
| Target Name | Inward rectifier potassium channel Kir2.1 (KCNJ2) | ||||
| Synonyms | hIRK1; Potassium channel, inwardly rectifying subfamily J member 2; Inward rectifier K(+) channel Kir2.1; IRK1; IRK-1; Cardiac inward rectifier potassium channel | ||||
| Target Type | Literature-reported Target | ||||
| Gene Name | KCNJ2 | ||||
| Biochemical Class | Inward rectifier potassium channel | ||||
| UniProt ID | |||||
| The microRNAs (miRNAs) Regulating This Target | Top | ||||
|---|---|---|---|---|---|
| miRNA Mature ID | hsa-miR-1-3p | miRNA Info | |||
| miRNA Mature AC | |||||
| Sequence | uggaauguaaagaaguauguau | ||||
| miRNA Species | Homo sapiens | ||||
| Evidence Score (E-score) | 1 | + | |||
| 1 | Luciferase Reporter Assay | [1] | |||
| Representative Target(s) Regulated by This miRNA | Apoptosis regulator Bcl-2 (BCL-2) | Target Info | |||
| Brain-derived neurotrophic factor (BDNF) | Target Info | ||||
| miRNA Mature ID | hsa-miR-212-3p | miRNA Info | |||
| miRNA Mature AC | |||||
| Sequence | uaacagucuccagucacggcc | ||||
| miRNA Species | Homo sapiens | ||||
| Regulation Mechanism | miRNA target sites in the Kir2.1 3'UTR. | [2] | |||
| Evidence Score (E-score) | 1 | + | |||
| 1 | Luciferase Reporter Assay | [2] | |||
| Representative Target(s) Regulated by This miRNA | Acetylcholinesterase (AChE) | Target Info | |||
| Adenylate cyclase type 1 (ADCY1) | Target Info | ||||
| miRNA Mature ID | hsa-miR-7-1-3p | miRNA Info | |||
| miRNA Mature AC | |||||
| Sequence | caacaaaucacagucugccaua | ||||
| miRNA Species | Homo sapiens | ||||
| Regulation Mechanism | miR-7 directly regulates KCNJ2 expression in SCLC. | [3] | |||
| Evidence Score (E-score) | 1 | + | |||
| 1 | Luciferase Reporter Assay | [3] | |||
| Representative Target(s) Regulated by This miRNA | Epidermal growth factor receptor (EGFR) | Target Info | |||
| Insulin-like growth factor I receptor (IGF1R) | Target Info | ||||
| References | Top | ||||
|---|---|---|---|---|---|
| REF 1 | The muscle-specific microRNA miR-1 regulates cardiac arrhythmogenic potential by targeting GJA1 and KCNJ2. Nat Med. 2007 Apr;13(4):486-91. | ||||
| REF 2 | A novel dual-fluorescence strategy for functionally validating microRNA targets in 3' untranslated regions: regulation of the inward rectifier potassium channel K(ir)2.1 by miR-212. Biochem J. 2012 Nov 15;448(1):103-13. | ||||
| REF 3 | Upregulation of the inwardly rectifying potassium channel Kir2.1 (KCNJ2) modulates multidrug resistance of small-cell lung cancer under the regulation of miR-7 and the Ras/MAPK pathway. Mol Cancer. 2015 Mar 12;14:59. | ||||
If You Find Any Error in Data or Bug in Web Service, Please Kindly Report It to Dr. Zhou and Dr. Zhang.