miRNA Details
| miRNA General Information | |||||
|---|---|---|---|---|---|
| miRNA Mature ID | hsa-let-7b-5p | ||||
| miRNA Stemloop AC | MI0000063 | ||||
| miRNA Stemloop ID | hsa-let-7b | ||||
| Sequence | ugagguaguagguugugugguu | ||||
| TTD Target(s) Regulated by This miRNA | Platelet-derived growth factor receptor alpha (PDGFRA) | Successful Target | Target Info | [1] | |
| Cyclin-dependent kinase 6 (CDK6) | Successful Target | Target Info | [2] | ||
| Insulin-like growth factor I receptor (IGF1R) | Successful Target | Target Info | [3] | ||
| Interferon-beta (IFNB1) | Successful Target | Target Info | [4] | ||
| TGF-beta receptor type I (TGFBR1) | Clinical trial Target | Target Info | [5] | ||
| Enhancer of zeste homolog 2 (EZH2) | Successful Target | Target Info | [6] | ||
| Toll-like receptor 4 (TLR4) | Clinical trial Target | Target Info | [7] | ||
| TRAIL receptor 2 (TRAIL-R2) | Clinical trial Target | Target Info | [8] | ||
| G1/S-specific cyclin-D1 (CCND1) | Clinical trial Target | Target Info | [9] | ||
| GTPase NRas (NRAS) | Clinical trial Target | Target Info | [10] | ||
| Activin receptor-like kinase 2 (ALK-2) | Clinical trial Target | Target Info | [11] | ||
| M-phase inducer phosphatase 1 (MPIP1) | Literature-reported Target | Target Info | [12] | ||
| RAC-beta serine/threonine-protein kinase (AKT2) | Literature-reported Target | Target Info | [13] | ||
| Cyclin A2 (CCNA2) | Literature-reported Target | Target Info | [9] | ||
| GTPase HRas (HRAS) | Literature-reported Target | Target Info | [14] | ||
| CDK inhibitor 1B p27Kip1 (CDKN1B) | Literature-reported Target | Target Info | [15] | ||
| High mobility group protein HMG-I/Y (HMGA1) | Literature-reported Target | Target Info | [10] | ||
| Melanoma differentiation-associated protein 6 (CDKN1A) | Literature-reported Target | Target Info | [3] | ||
| Transcription factor E2F2 (E2F2) | Literature-reported Target | Target Info | [16] | ||
| High mobility group protein HMGI-C (HMGA2) | Literature-reported Target | Target Info | [17] | ||
| Protein(s) Regulated by This miRNA | Actin, cytoplasmic 2 | Regulated Protein | [18] | ||
| Anaphase-promoting complex subunit 1 | Regulated Protein | [19] | |||
| B-cell CLL/lymphoma 7 protein family member A | Regulated Protein | [20] | |||
| Baculoviral IAP repeat-containing protein 6 | Regulated Protein | [1] | |||
| Collagen alpha-1(III) chain | Regulated Protein | [11] | |||
| Collagen triple helix repeat-containing protein 1 | Regulated Protein | [23] | |||
| Cyclin-A1 | Regulated Protein | [9] | |||
| Cytochrome P450 2J2 | Regulated Protein | [25] | |||
| Cytoplasmic polyadenylation element-binding protein 1 | Regulated Protein | [11] | |||
| Cytoplasmic polyadenylation element-binding protein 3 | Regulated Protein | [11] | |||
| Cytoplasmic polyadenylation element-binding protein 4 | Regulated Protein | [11] | |||
| G1/S-specific cyclin-D2 | Regulated Protein | [12] | |||
| Heterogeneous nuclear ribonucleoprotein D-like | Regulated Protein | [1] | |||
| Insulin receptor substrate 2 | Regulated Protein | [27] | |||
| Insulin-like growth factor 2 mRNA-binding protein 1 | Regulated Protein | [14] | |||
| Insulin-like growth factor 2 mRNA-binding protein 2 | Regulated Protein | [29] | |||
| Leucine-rich repeat-containing G-protein coupled receptor 4 | Regulated Protein | [30] | |||
| Leucine-rich repeats and immunoglobulin-like domains protein 1 | Regulated Protein | [11] | |||
| Myotrophin | Regulated Protein | [31] | |||
| Nuclear receptor subfamily 2 group E member 1 | Regulated Protein | [32] | |||
| PR domain zinc finger protein 1 | Regulated Protein | [33] | |||
| Protein argonaute-1 | Regulated Protein | [34] | |||
| Protein lin-28 homolog A | Regulated Protein | [18] | |||
| Protein lin-28 homolog B | Regulated Protein | [35] | |||
| Ribose-5-phosphate isomerase | Regulated Protein | [18] | |||
| Secretory carrier-associated membrane protein 3 | Regulated Protein | [1] | |||
| Ubiquitin-conjugating enzyme E2 R1 | Regulated Protein | [14] | |||
| Ubiquitin-conjugating enzyme E2 R1 | Regulated Protein | [36] | |||
| References | |||||
| REF 1 | MicroRNA let-7a down-regulates MYC and reverts MYC-induced growth in Burkitt lymphoma cells. Cancer Res. 2007 Oct 15;67(20):9762-70. | ||||
| REF 2 | Physiological identification of human transcripts translationally regulated by a specific microRNA. Hum Mol Genet. 2005 Dec 15;14(24):3813-21. | ||||
| REF 3 | A quantitative analysis of CLIP methods for identifying binding sites of RNA-binding proteins. Nat Methods. 2011 May 15;8(7):559-64. | ||||
| REF 4 | MicroRNA regulation of IFN-beta protein expression: rapid and sensitive modulation of the innate immune response. J Immunol. 2010 Mar 1;184(5):2369-76. | ||||
| REF 5 | Differentially expressed plasma microRNAs and the potential regulatory function of Let-7b in chronic thromboembolic pulmonary hypertension. PLoS One. 2014 Jun 30;9(6):e101055. | ||||
| REF 6 | Genome-wide mRNA and miRNA expression profiling reveal multiple regulatory networks in colorectal cancer. Cell Death Dis. 2015 Jan 22;6:e1614. | ||||
| REF 7 | Let-7b is involved in the inflammation and immune responses associated with Helicobacter pylori infection by targeting Toll-like receptor 4. PLoS One. 2013;8(2):e56709. | ||||
| REF 8 | Nuclear death receptor TRAIL-R2 inhibits maturation of let-7 and promotes proliferation of pancreatic and other tumor cells. Gastroenterology. 2014 Jan;146(1):278-90. | ||||
| REF 9 | MicroRNA let-7b targets important cell cycle molecules in malignant melanoma cells and interferes with anchorage-independent growth. Cell Res. 2008 May;18(5):549-57. | ||||
| REF 10 | Widespread changes in protein synthesis induced by microRNAs.Nature. 2008 Sep 4;455(7209):58-63. | ||||
| REF 11 | Fibroblast growth factor (FGF) signaling during gastrulation negatively modulates the abundance of microRNAs that regulate proteins required for cell migration and embryo patterning. J Biol Chem. 2012 Nov 9;287(46):38505-14. | ||||
| REF 12 | The let-7 microRNA represses cell proliferation pathways in human cells. Cancer Res. 2007 Aug 15;67(16):7713-22. | ||||
| REF 13 | let-7b/g silencing activates AKT signaling to promote gastric carcinogenesis. J Transl Med. 2014 Oct 5;12:281. | ||||
| REF 14 | IMP-1 displays cross-talk with K-Ras and modulates colon cancer cell survival through the novel proapoptotic protein CYFIP2. Cancer Res. 2011 Mar 15;71(6):2172-82. | ||||
| REF 15 | DICER-dependent biogenesis of let-7 miRNAs affects human cell response to DNA damage via targeting p21/p27. Nucleic Acids Res. 2015 Feb 18;43(3):1626-36. | ||||
| REF 16 | Let-7b inhibits the malignant behavior of glioma cells and glioma stem-like cells via downregulation of E2F2. J Physiol Biochem. 2016 Dec;72(4):733-744. | ||||
| REF 17 | High mobility group A2 is a target for miRNA-98 in head and neck squamous cell carcinoma. Mol Cancer. 2007 Jan 14;6:5. | ||||
| REF 18 | A combined computational-experimental approach predicts human microRNA targets. Genes Dev. 2004 May 15;18(10):1165-78. | ||||
| REF 19 | Screening key microRNAs for castration-resistant prostate cancer based on miRNA/mRNA functional synergistic network. Oncotarget. 2015 Dec 22;6(41):43819-30. | ||||
| REF 20 | Using expression profiling data to identify human microRNA targets. Nat Methods. 2007 Dec;4(12):1045-9. | ||||
| REF 21 | MicroRNA let-7a down-regulates MYC and reverts MYC-induced growth in Burkitt lymphoma cells. Cancer Res. 2007 Oct 15;67(20):9762-70. | ||||
| REF 22 | Fibroblast growth factor (FGF) signaling during gastrulation negatively modulates the abundance of microRNAs that regulate proteins required for cell migration and embryo patterning. J Biol Chem. 2012 Nov 9;287(46):38505-14. | ||||
| REF 23 | Let-7b inhibits cell proliferation, migration, and invasion through targeting Cthrc1 in gastric cancer.Tumour Biol. 2015 May;36(5):3221-9. | ||||
| REF 24 | MicroRNA let-7b targets important cell cycle molecules in malignant melanoma cells and interferes with anchorage-independent growth. Cell Res. 2008 May;18(5):549-57. | ||||
| REF 25 | Let-7b inhibits human cancer phenotype by targeting cytochrome P450 epoxygenase 2J2.PLoS One. 2012;7(6):e39197. | ||||
| REF 26 | The let-7 microRNA represses cell proliferation pathways in human cells. Cancer Res. 2007 Aug 15;67(16):7713-22. | ||||
| REF 27 | IGF-1R, a target of let-7b, mediates crosstalk between IRS-2/Akt and MAPK pathways to promote proliferation of oral squamous cell carcinoma.Oncotarget. 2014 May 15;5(9):2562-74. | ||||
| REF 28 | IMP-1 displays cross-talk with K-Ras and modulates colon cancer cell survival through the novel proapoptotic protein CYFIP2. Cancer Res. 2011 Mar 15;71(6):2172-82. | ||||
| REF 29 | Lin28b promotes head and neck cancer progression via modulation of the insulin-like growth factor survival pathway. Oncotarget. 2012 Dec;3(12):1641-52. | ||||
| REF 30 | MicroRNA let-7b induces lens epithelial cell apoptosis by targeting leucine-rich repeat containing G protein-coupled receptor 4 (Lgr4) in age-related cataract.Exp Eye Res. 2016 Jun;147:98-104. | ||||
| REF 31 | Combinatorial microRNA target predictions.Nat Genet. 2005 May;37(5):495-500. | ||||
| REF 32 | MicroRNA let-7b regulates neural stem cell proliferation and differentiation by targeting nuclear receptor TLX signaling. Proc Natl Acad Sci U S A. 2010 Feb 2;107(5):1876-81. | ||||
| REF 33 | Epigenetic down-regulation of the tumor suppressor gene PRDM1/Blimp-1 in diffuse large B cell lymphomas: a potential role of the microRNA let-7.Am J Pathol. 2010 Sep;177(3):1470-9. | ||||
| REF 34 | Hypoxia-responsive miRNAs target argonaute 1 to promote angiogenesis.J Clin Invest. 2013 Mar;123(3):1057-67. | ||||
| REF 35 | Identification and characterization of lin-28 homolog B (LIN28B) in human hepatocellular carcinoma.Gene. 2006 Dec 15;384:51-61. | ||||
| REF 36 | let-7 Overexpression leads to an increased fraction of cells in G2/M, direct down-regulation of Cdc34, and stabilization of Wee1 kinase in primary fibroblasts.J Biol Chem. 2009 Mar 13;284(11):6605-9. | ||||
If You Find Any Error in Data or Bug in Web Service, Please Kindly Report It to Dr. Zhou and Dr. Zhang.