Target Regulator(s) Information (MicroRNA)

Content Navigation (  All   None )                                      
Target General Information
The microRNAs (miRNAs) Regulating This Target
References
Target General Information  Top
Target ID T01851 Target Info
Target Name Integrin beta-1 (ITGB1)
Synonyms VLA-4 subunit beta; MSK12; MDF2; Integrin VLA-4 beta subunit; Glycoprotein IIa; GPIIA; Fibronectin receptor subunit beta; Fibronectin receptor beta subunit; FNRB; CD29 antigen; CD29; Beta(1) integrin
Target Type Clinical trial Target
Gene Name ITGB1
Biochemical Class Integrin
UniProt ID
P05556
The microRNAs (miRNAs) Regulating This Target  Top
miRNA Mature ID hsa-miR-192-5p miRNA Info
miRNA Mature AC
MIMAT0000222
Sequence cugaccuaugaauugacagcc
miRNA Species Homo sapiens
Evidence Score (E-score) 2 +
1 Immunofluorescence; Luciferase Reporter Assay; Western Blot [1]
2 Microarray [2]
Representative Target(s) Regulated by This miRNA Activated leukocyte cell adhesionmolecule (ALCAM) Target Info
CD166_HUMAN
Activin receptor type IIB (ACVR2B) Target Info
AVR2B_HUMAN
miRNA Mature ID hsa-miR-29a-3p miRNA Info
miRNA Mature AC
MIMAT0000086
Sequence uagcaccaucugaaaucgguua
miRNA Species Homo sapiens
Regulation Mechanism hTERT mediates gastric cancer metastasis partially through the indirect targeting of ITGB1 by miR-29a. [3]
Evidence Score (E-score) 2 +
1 Luciferase Reporter Assay; Western Blot [3]
2 Luciferase Reporter Assay; Western Blot [4]
Representative Target(s) Regulated by This miRNA Apoptosis regulator Bcl-2 (BCL-2) Target Info
BCL2_HUMAN
Aryl hydrocarbon receptor (AHR) Target Info
AHR_HUMAN
miRNA Mature ID hsa-miR-29c-3p miRNA Info
miRNA Mature AC
MIMAT0000681
Sequence uagcaccauuugaaaucgguua
miRNA Species Homo sapiens
Regulation Mechanism miR-29c acts as a tumour suppressor in GC by directly targeting ITGB1. [6]
Evidence Score (E-score) 2 +
1 Luciferase Reporter Assay; qRT-PCR [5]
2 Luciferase Reporter Assay; Western Blot [6]
Representative Target(s) Regulated by This miRNA Apoptosis regulator Bcl-2 (BCL-2) Target Info
BCL2_HUMAN
B7 homolog 3 (CD276) Target Info
CD276_HUMAN
miRNA Mature ID hsa-miR-130b-3p miRNA Info
miRNA Mature AC
MIMAT0000691
Sequence cagugcaaugaugaaagggcau
miRNA Species Homo sapiens
Regulation Mechanism miR-130b downregulates its target-integrin b1, leading to the impaired migration and invasion of CRC cells. [7]
Evidence Score (E-score) 1 +
1 Luciferase Reporter Assay; Western Blot [7]
Representative Target(s) Regulated by This miRNA Acyl-CoA desaturase (SCD) Target Info
ACOD_HUMAN
Cyclin A2 (CCNA2) Target Info
CCNA2_HUMAN
miRNA Mature ID hsa-miR-134-5p miRNA Info
miRNA Mature AC
MIMAT0000447
Sequence ugugacugguugaccagagggg
miRNA Species Homo sapiens
Regulation Mechanism Integrin beta 1 (ITGB1) was a direct and functional target gene of miR-134. [8]
Evidence Score (E-score) 1 +
1 Luciferase Reporter Assay [8]
Representative Target(s) Regulated by This miRNA Angiopoietin-related protein 4 (ANGPTL4) Target Info
ANGL4_HUMAN
Erbb2 tyrosine kinase receptor (HER2) Target Info
ERBB2_HUMAN
miRNA Mature ID hsa-miR-143-3p miRNA Info
miRNA Mature AC
MIMAT0000435
Sequence ugagaugaagcacuguagcuc
miRNA Species Homo sapiens
Regulation Mechanism Intervention with the miR-143 mimic, the mRNA and protein expression levels of ITGB1 all were decreased. [9]
Evidence Score (E-score) 1 +
1 qRT-PCR; Western Blot [9]
Representative Target(s) Regulated by This miRNA Apoptosis regulator Bcl-2 (BCL-2) Target Info
BCL2_HUMAN
Connective tissue growth factor (CTGF) Target Info
CTGF_HUMAN
miRNA Mature ID hsa-miR-183-5p miRNA Info
miRNA Mature AC
MIMAT0000261
Sequence uauggcacugguagaauucacu
miRNA Species Homo sapiens
Evidence Score (E-score) 1 +
1 Immunoblot; Immunocytochemistry; Luciferase Reporter Assay [10]
Representative Target(s) Regulated by This miRNA Dickkopf-related protein 3 (DKK3) Target Info
DKK3_HUMAN
Early growth response protein 1 (EGR-1) Target Info
EGR1_HUMAN
References  Top
REF 1 miR-192 suppresses leptomeningeal dissemination of medulloblastoma by modulating cell proliferation and anchoring through the regulation of DHFR, integrins, and CD47. Oncotarget. 2015 Dec 22;6(41):43712-30.
REF 2 Coordinated regulation of cell cycle transcripts by p53-Inducible microRNAs, miR-192 and miR-215. Cancer Res. 2008 Dec 15;68(24):10105-12.
REF 3 hTERT mediates gastric cancer metastasis partially through the indirect targeting of ITGB1 by microRNA-29a. Sci Rep. 2016 Feb 23;6:21955.
REF 4 Inhibition of integrin 1-mediated oncogenic signalling by the antitumor microRNA-29 family in head and neck squamous cell carcinoma. Oncotarget. 2017 Dec 11;9(3):3663-3676.
REF 5 MiR-29c inhibits cell growth, invasion, and migration of pancreatic cancer by targeting ITGB1. Onco Targets Ther. 2015 Dec 30;9:99-109.
REF 6 MicroRNA-29c mediates initiation of gastric carcinogenesis by directly targeting ITGB1. Gut. 2015 Feb;64(2):203-14.
REF 7 MicroRNA- 130b suppresses migration and invasion of colorectal cancer cells through downregulation of integrin 1 [corrected]. PLoS One. 2014 Feb 3;9(2):e87938.
REF 8 Genome-wide screening identified that miR-134 acts as a metastasis suppressor by targeting integrin 1 in hepatocellular carcinoma. PLoS One. 2014 Feb 3;9(2):e87665.
REF 9 miR-143 down-regulates TLR2 expression in hepatoma cells and inhibits hepatoma cell proliferation and invasion. Int J Clin Exp Pathol. 2015 Oct 1;8(10):12738-47.
REF 10 Targeting of integrin beta1 and kinesin 2alpha by microRNA 183. J Biol Chem. 2010 Feb 19;285(8):5461-71.

If You Find Any Error in Data or Bug in Web Service, Please Kindly Report It to Dr. Zhou and Dr. Zhang.