Target Regulator(s) Information (MicroRNA)

Content Navigation (  All   None )                                      
Target General Information
The microRNAs (miRNAs) Regulating This Target
References
Target General Information  Top
Target ID T36729 Target Info
Target Name NADPH oxidase 2 (CYBB)
Synonyms p22 phagocyte Bcytochrome; p22 phagocyte B-cytochrome; gp91phox; gp911; gp91-phox; gp91-1; Superoxidegenerating NADPH oxidase heavy chain subunit; Superoxide-generating NADPH oxidase heavy chain subunit; Neutrophil cytochrome b 91 kDa polypeptide; NOX2; Hemebinding membrane glycoprotein gp91phox; Heme-binding membrane glycoprotein gp91phox; Cytochrome b558 subunit beta; Cytochrome b245 heavy chain; Cytochrome b-245 heavy chain; Cytochrome b(558) subunit beta; CGD91phox; CGD91-phox
Target Type Literature-reported Target
Gene Name CYBB
Biochemical Class Phagocyte NADPH oxidase
UniProt ID
P04839
The microRNAs (miRNAs) Regulating This Target  Top
miRNA Mature ID hsa-miR-106b-5p miRNA Info
miRNA Mature AC
MIMAT0000680
Sequence uaaagugcugacagugcagau
miRNA Species Homo sapiens
Regulation Mechanism miR-106b were able to improve heart function after myocardial infarction in mice by targeting CYBB and possibly altering inflammatory cytokine production. [1]
Evidence Score (E-score) 1 +
1 ELISA; Luciferase Reporter Assay; Western Blot [1]
Representative Target(s) Regulated by This miRNA Amyloid beta A4 protein (APP) Target Info
A4_HUMAN
Apoptosis mediating surface antigen FAS (FAS) Target Info
TNR6_HUMAN
miRNA Mature ID hsa-miR-148b-3p miRNA Info
miRNA Mature AC
MIMAT0000759
Sequence ucagugcaucacagaacuuugu
miRNA Species Homo sapiens
Regulation Mechanism miR-148 were able to improve heart function after myocardial infarction in mice by targeting CYBB and possibly altering inflammatory cytokine production. [1]
Evidence Score (E-score) 1 +
1 ELISA; Luciferase Reporter Assay; Western Blot [1]
Representative Target(s) Regulated by This miRNA Activated leukocyte cell adhesionmolecule (ALCAM) Target Info
CD166_HUMAN
Activin receptor-like kinase 2 (ALK-2) Target Info
ACVR1_HUMAN
miRNA Mature ID hsa-miR-204-5p miRNA Info
miRNA Mature AC
MIMAT0000265
Sequence uucccuuugucauccuaugccu
miRNA Species Homo sapiens
Regulation Mechanism miR-204 were able to improve heart function after myocardial infarction in mice by targeting CYBB and possibly altering inflammatory cytokine production. [1]
Evidence Score (E-score) 1 +
1 ELISA; Luciferase Reporter Assay; Western Blot [1]
Representative Target(s) Regulated by This miRNA Alkaline phosphatase tissue-nonspecific (ALPL) Target Info
PPBT_HUMAN
Apoptosis regulator Bcl-2 (BCL-2) Target Info
BCL2_HUMAN
miRNA Mature ID hsa-miR-34a-5p miRNA Info
miRNA Mature AC
MIMAT0000255
Sequence uggcagugucuuagcugguugu
miRNA Species Homo sapiens
Regulation Mechanism CYBB density was significantly decreased, upon transfection of the human glioma cell line, A172, with miR-34a inhibitors . And after transfection with miR-34a mimics, CYBB expression was increased, which concluding that miR-34a regulates NOX2 in human glioma cells and tissues. [2]
Evidence Score (E-score) 1 +
1 Western Blot [2]
Representative Target(s) Regulated by This miRNA Amphiregulin (AREG) Target Info
AREG_HUMAN
Androgen receptor (AR) Target Info
ANDR_HUMAN
References  Top
REF 1 High-throughput screening identifies microRNAs that target Nox2 and improve function after acute myocardial infarction. Am J Physiol Heart Circ Physiol. 2017 May 1;312(5):H1002-H1012.
REF 2 MicroRNA-34a induces apoptosis in the human glioma cell line, A172, through enhanced ROS production and NOX2 expression. Biochem Biophys Res Commun. 2014 Jan 31;444(1):6-12.

If You Find Any Error in Data or Bug in Web Service, Please Kindly Report It to Dr. Zhou and Dr. Zhang.