Target Regulator(s) Information (MicroRNA)

Content Navigation (  All   None )                                      
Target General Information
The microRNAs (miRNAs) Regulating This Target
References
Target General Information  Top
Target ID T64597 Target Info
Target Name Integrin beta-8 (ITGB8)
Synonyms Integrin subunit beta 8
Target Type Clinical trial Target
Gene Name ITGB8
Biochemical Class Integrin
UniProt ID
P26012
The microRNAs (miRNAs) Regulating This Target  Top
miRNA Mature ID hsa-miR-145-5p miRNA Info
miRNA Mature AC
MIMAT0000437
Sequence guccaguuuucccaggaaucccu
miRNA Species Homo sapiens
Regulation Mechanism miR-145 binds in human ITGB8 3'UTR. [1]
Evidence Score (E-score) 2 +
1 Luciferase Reporter Assay; GFP Reporter Assay; Western Blot [1]
2 Luciferase Reporter Assay; Western Blot [1]
Representative Target(s) Regulated by This miRNA A proliferation-inducing ligand (APRIL) Target Info
TNF13_HUMAN
Alkaline phosphatase (ALPPL2) Target Info
PPBN_HUMAN
miRNA Mature ID hsa-miR-20a-5p miRNA Info
miRNA Mature AC
MIMAT0000075
Sequence uaaagugcuuauagugcagguag
miRNA Species Homo sapiens
Regulation Mechanism miR-20 regulated OSCC migration through inhibiting the downstream target ITGb8. [2]
Evidence Score (E-score) 2 +
1 Luciferase Reporter Assay [2]
2 Luciferase Reporter Assay [3]
Representative Target(s) Regulated by This miRNA Amyloid beta A4 protein (APP) Target Info
A4_HUMAN
Apoptosis regulator Bcl-2 (BCL-2) Target Info
BCL2_HUMAN
miRNA Mature ID hsa-miR-148a-3p miRNA Info
miRNA Mature AC
MIMAT0000243
Sequence ucagugcacuacagaacuuugu
miRNA Species Homo sapiens
Evidence Score (E-score) 1 +
1 Luciferase Reporter Assay [4]
Representative Target(s) Regulated by This miRNA Activated leukocyte cell adhesionmolecule (ALCAM) Target Info
CD166_HUMAN
Activin receptor-like kinase 2 (ALK-2) Target Info
ACVR1_HUMAN
miRNA Mature ID hsa-miR-17-5p miRNA Info
miRNA Mature AC
MIMAT0000070
Sequence caaagugcuuacagugcagguag
miRNA Species Homo sapiens
Regulation Mechanism miR-17 regulated OSCC migration through inhibiting the downstream target ITGb8. [2]
Evidence Score (E-score) 1 +
1 Luciferase Reporter Assay [2]
Representative Target(s) Regulated by This miRNA Amyloid beta A4 protein (APP) Target Info
A4_HUMAN
Apoptosis mediating surface antigen FAS (FAS) Target Info
TNR6_HUMAN
miRNA Mature ID hsa-miR-19b-1-5p miRNA Info
miRNA Mature AC
MIMAT0004491
Sequence aguuuugcagguuugcauccagc
miRNA Species Homo sapiens
Evidence Score (E-score) 1 +
1 Luciferase Reporter Assay [5]
Representative Target(s) Regulated by This miRNA Caspase-8 (CASP8) Target Info
CASP8_HUMAN
Fibroblast growth factor receptor 2 (FGFR2) Target Info
FGFR2_HUMAN
miRNA Mature ID hsa-miR-93-5p miRNA Info
miRNA Mature AC
MIMAT0000093
Sequence caaagugcuguucgugcagguag
miRNA Species Homo sapiens
Regulation Mechanism miR-93 targets ITGB8. [6]
Evidence Score (E-score) 1 +
1 Luciferase Reporter Assay; Western Blot [6]
Representative Target(s) Regulated by This miRNA Angiogenin (ANG) Target Info
ANGI_HUMAN
ATP-binding cassette transporter A1 (ABCA1) Target Info
ABCA1_HUMAN
References  Top
REF 1 MicroRNA-145 regulates human corneal epithelial differentiation. PLoS One. 2011;6(6):e21249.
REF 2 MicroRNA-17/20a functions to inhibit cell migration and can be used a prognostic marker in oral squamous cell carcinoma. Oral Oncol. 2013 Sep;49(9):923-931.
REF 3 Differential regulation of aggressive features in melanoma cells by members of the miR-17-92 complex. Open Biol. 2014 Jun;4(6):140030.
REF 4 Integrative network analysis reveals active microRNAs and their functions in gastric cancer. BMC Syst Biol. 2011 Jun 26;5:99.
REF 5 MiR-19b-1 inhibits angiogenesis by blocking cell cycle progression of endothelial cells. Biochem Biophys Res Commun. 2012 Jan 13;417(2):771-6.
REF 6 MicroRNA miR-93 promotes tumor growth and angiogenesis by targeting integrin-8. Oncogene. 2011 Feb 17;30(7):806-21.

If You Find Any Error in Data or Bug in Web Service, Please Kindly Report It to Dr. Zhou and Dr. Zhang.